tag:blogger.com,1999:blog-23355150418638384162024-03-14T09:35:01.386+01:00Vallve's BlogAnècdotes i curiositats científiques i altresVallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.comBlogger76125tag:blogger.com,1999:blog-2335515041863838416.post-39412134871819317572010-06-26T00:01:00.017+02:002010-06-26T00:01:01.653+02:0010è aniversari del genoma humà<div style="text-align: justify;">Avui és el desè aniversari de la conferència de premsa conjunta que el Sr Bill Clinton, el Sr. Tony Blair (per videoconferència des del Regne Unit), el Dr <a href="http://vallve.blogspot.com/2008/12/craig-venter-un-ferm-candidat-al-nobel.html">Craig Venter</a> (com a representant de la companyia Celera Genomics) i el Dr <a href="http://ca.wikipedia.org/wiki/Francis_Collins">Francis Collins</a> (com a representant del consorci públic) van fer el 26 de Juny del 2000 per anunciar a tot el món que finalment s'havia seqüenciat el <a href="http://ca.wikipedia.org/wiki/Genoma_hum%C3%A0">genoma humà</a>. Es posava fi així, amb un empat tècnic, a la "<a href="http://vallve.blogspot.com/2008/10/la-guerra-dels-genomes-i-ciencia-amb.html">guerra</a>" oberta entre un <a href="http://ca.wikilingue.com/es/Projecto_Genoma_Hum%C3%A0">consorci públic</a> que feia anys que havia engegat el projecte de seqüenciació del genoma humà i una companyia privada, Celera Genomics, que al 1998 va anunciar que entrava en la cursa per a seqüenciar el genoma humà.<br /><br />Després de 10 anys és un bon moment per fer balanç. Com no podia ser d'una altra manera, la notícia de la seqüenciació del genoma humà va tenir molta repercussió mediàtica. Alguns dels titulars de fa 10 anys van ser:<br /><center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh_xNosGzn2Uy_KmSoTMKa4nW9UqPeTT-DOxY6tVdYaDhWjqID76NCwxeNXoIHmZThBBFF1AwqwMJ8YKiAlrzwnMMAKEygWUnAlyE6QIewfKw0yTsMhKxIaPAD9AFkAdSIICcWHSg2LtWA/s1600/Imagen1.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 195px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh_xNosGzn2Uy_KmSoTMKa4nW9UqPeTT-DOxY6tVdYaDhWjqID76NCwxeNXoIHmZThBBFF1AwqwMJ8YKiAlrzwnMMAKEygWUnAlyE6QIewfKw0yTsMhKxIaPAD9AFkAdSIICcWHSg2LtWA/s320/Imagen1.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5486090985247982386" /></a><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiKut8CeGm5ASEj8QvxLKs4hXlzn2D3ywsmiyBfy6Cy_TI4gH8Cea8xAEn857aA77WshLHUTFUSmpP2GHei-T8OaYZN5ZUelwekXrPIuTmcdvfg5EvbAaOG6R38lqUgmhwfOMRN5wkdmkY/s1600/Imagen2.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 202px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiKut8CeGm5ASEj8QvxLKs4hXlzn2D3ywsmiyBfy6Cy_TI4gH8Cea8xAEn857aA77WshLHUTFUSmpP2GHei-T8OaYZN5ZUelwekXrPIuTmcdvfg5EvbAaOG6R38lqUgmhwfOMRN5wkdmkY/s320/Imagen2.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5486092156269891938" /></a><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEinl8WEbBCmGJCU-UhQFUEiTsCK3M1MXemLk6Kts1UnkWmzJMF9RuYnrzUGrgo_HimGm12qZDmC9G0-ePH36BfoqVpBVql_ZWjEiUSKbZyuBBff51z1m2UhmOEzAAHGniT1wAVdmHOuPWM/s1600/Imagen3.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 222px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEinl8WEbBCmGJCU-UhQFUEiTsCK3M1MXemLk6Kts1UnkWmzJMF9RuYnrzUGrgo_HimGm12qZDmC9G0-ePH36BfoqVpBVql_ZWjEiUSKbZyuBBff51z1m2UhmOEzAAHGniT1wAVdmHOuPWM/s320/Imagen3.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5486091989939998850" /></a><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgZ1SSbDpetSBBsSNXxxaAOrrcVT_vgCm-NJcfUQkogs2xlCj8qX5a8QvLQPjwek7RMznjjl2LiAf2ukeyC1Us8H5hcXAYDNyV0doAVUTnk1DgguL4RHBRKf5x89A2BIMyLFEK9Ylz8O1Q/s1600/Imagen4.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 98px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgZ1SSbDpetSBBsSNXxxaAOrrcVT_vgCm-NJcfUQkogs2xlCj8qX5a8QvLQPjwek7RMznjjl2LiAf2ukeyC1Us8H5hcXAYDNyV0doAVUTnk1DgguL4RHBRKf5x89A2BIMyLFEK9Ylz8O1Q/s320/Imagen4.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5486091903077187554" /></a><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi1X4B5u4y2NguAlJnMDYsJIepy_olaXoj8sJfiHZBmAdz0i7euJgjGRckom55FOrLDGXw4aDWgp2wv3Tpj-Ur2PZf-am76F705iDN4C8RKSsXUs-ILSyBXFwcUdYjTXD7VF-wU8EQwHy4/s1600/Imagen5.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 261px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi1X4B5u4y2NguAlJnMDYsJIepy_olaXoj8sJfiHZBmAdz0i7euJgjGRckom55FOrLDGXw4aDWgp2wv3Tpj-Ur2PZf-am76F705iDN4C8RKSsXUs-ILSyBXFwcUdYjTXD7VF-wU8EQwHy4/s320/Imagen5.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5486091760998467938" /></a></center><br />El fet de disposar de la seqüència del genoma humà no ha tingut tanta repercussió, especialment en el camp biomèdic, com es pensava. Possiblement perquè la realitat és més complexa del que pensem i encara no en sabem prou. Tot i això, ja es comença a utilitzar la informació dels genomes dels individus i sembla que dintre d'uns anys, seqüenciar-nos el genoma de cada un serà una possibilitat per a les persones que es vulguin/puguin gastar 1000$. Aquest és el preu que es pensa que s'hauria d'arribar per a que comencés la seqüenciació en massa del genoma humà. I sembla que no estem tant lluny d'arribar-hi. S'estima que avui en dia seqüenciar el genoma humà d'un individu costa al voltant dels 3000$, molt lluny dels 3000 mil·lions de $ que es creu que es va gastar el consorci públic fa 10 anys.<br /><br />Com a curiositat en aquest desè aniversari us transcric el discurs de la conferència de premsa abans esmentada. També la podeu sentir en <a href="http://clinton5.nara.gov/media/au/genome-20000626.au" target="audio">aquest enllaç</a>.<br /><br /><BLOCKQUOTE><br /><center>THE WHITE HOUSE<br /><br />Office of the Press Secretary<br />______________________________________________________________________________<br /><br />For Immediate Release June 26, 2000<br /><br /><B>REMARKS BY THE PRESIDENT,<br />PRIME MINISTER TONY BLAIR OF ENGLAND (VIA SATELLITE),<br />DR. FRANCIS COLLINS, DIRECTOR OF THE NATIONAL<br />HUMAN GENOME RESEARCH INSTITUTE, AND<br />DR. CRAIG VENTER, PRESIDENT AND CHIEF SCIENTIFIC<br />OFFICER, CELERA GENOMICS CORPORATION,<br />ON THE COMPLETION OF THE FIRST SURVEY OF<br />THE ENTIRE HUMAN GENOME PROJECT</B></CENTER><br /><br />The East Room<br /> <br /><br />10:19 A.M. EDT<br /><br /> THE PRESIDENT: Good morning. I want to, first of all, acknowledge Prime Minister Blair, who will join us by satellite in just a moment, from London. I want to welcome here the Ambassadors from the United Kingdom, Japan, Germany, France. And I'd also like to acknowledge the contributions not only that their scientists, but also scientists from China, made to the vast international consortium that is the Human Genome Project.<br /><br /> I thank Secretary Shalala, who could not be here today; and Secretary Richardson, who is here. Dr. Ruth Kirschstein, Dr. Ari Patrinos, scientists of the Department of Health and Human Services and the Department of Energy, who have played an important role in the Human Genome Project.<br /><br /> I want to say a special word of thanks to my Science Advisor, Dr. Neal Lane. And of course, to Dr. Francis Collins, the Director of the International Human Genome Project; and to the Celera President, Craig Venter. I thank Senator Harkin and Senator Sarbanes for being here, and the other distinguished guests.<br /><br /> Nearly two centuries ago, in this room, on this floor, Thomas Jefferson and a trusted aide spread out a magnificent map -- a map Jefferson had long prayed he would get to see in his lifetime. The aide was Meriwether Lewis and the map was the product of his courageous expedition across the American frontier, all the way to the Pacific. It was a map that defined the contours and forever expanded the frontiers of our continent and our imagination.<br /><br /> Today, the world is joining us here in the East Room to behold a map of even greater significance. We are here to celebrate the completion of the first survey of the entire human genome. Without a doubt, this is the most important, most wondrous map ever produced by humankind.<br /><br /> The moment we are here to witness was brought about through brilliant and painstaking work of scientists all over the world, including many men and women here today. It was not even 50 years ago that a young Englishman named Crick and a brash even younger American named Watson, first discovered the elegant structure of our genetic code. "Dr. Watson, the way you announced your discovery in the journal 'Nature,' was one of the great understatements of all time. This structure has novel features, which are of considerable biological interest." (Laughter.) Thank you, sir. (Applause.)<br /><br /> How far we have come since that day. In the intervening years, we have pooled the combined wisdom of biology, chemistry, physics, engineering, mathematics and computer science; tapped the great strengths and insights of the public and private sectors. More than 1,000 researchers across six nations have revealed nearly all 3 billion letters of our miraculous genetic code. I congratulate all of you on this stunning and humbling achievement.<br /><br /> Today's announcement represents more than just an epic-making triumph of science and reason. After all, when Galileo discovered he could use the tools of mathematics and mechanics to understand the motion of celestial bodies, he felt, in the words of one eminent researcher, "that he had learned the language in which God created the universe."<br /><br /> Today, we are learning the language in which God created life. We are gaining ever more awe for the complexity, the beauty, the wonder of God's most divine and sacred gift. With this profound new knowledge, humankind is on the verge of gaining immense, new power to heal. Genome science will have a real impact on all our lives -- and even more, on the lives of our children. It will revolutionize the diagnosis, prevention and treatment of most, if not all, human diseases.<br /><br /> In coming years, doctors increasingly will be able to cure diseases like Alzheimer's, Parkinson's, diabetes and cancer by attacking their genetic roots. Just to offer one example, patients with some forms of leukemia and breast cancer already are being treated in clinical trials with sophisticated new drugs that precisely target the faulty genes and cancer cells, with little or no risk to healthy cells. In fact, it is now conceivable that our children's children will know the term cancer only as a constellation of stars.<br /><br /> But today's historic achievement is only a starting point. There is much hard work yet to be done. That is why I'm so pleased to announce that from this moment forward, the robust and healthy competition that has led us to this day and that always is essential to the progress of science, will be coupled with enhanced public-private cooperation.<br /><br /> Public and private research teams are committed to publishing their genomic data simultaneously later this year, for the benefit of researchers in every corner of the globe. And after publication, both sets of teams will join together for an historic sequence analysis conference. Together, they will examine what scientific insights have been gleaned from both efforts, and how we can most judiciously proceed toward the next majestic horizons.<br /><br /> What are those next horizons? Well, first, we will complete a virtually error-free final draft of the human genome before the 50th anniversary of the discovery of the double helix, less than three years from now. Second, through sustained and vigorous support for public and private research, we must sort through this trove of genomic data to identify every human gene. We must discover the function of these genes and their protein products, and then we must rapidly convert that knowledge into treatments that can lengthen and enrich lives.<br /><br /> I want to emphasize that biotechnology companies are absolutely essential in this endeavor. For it is they who will bring to the market the life-enhancing applications of the information from the human genome. And for that reason, this administration is committed to helping them to make the kind of long-term investments that will change the face of medicine forever.<br /><br /> The third horizon that lies before us is one that science cannot approach alone. It is the horizon that represents the ethical, moral and spiritual dimension of the power we now possess. We must not shrink from exploring that far frontier of science. But as we consider how to use new discovery, we must also not retreat from our oldest and most cherished human values. We must ensure that new genome science and its benefits will be directed toward making life better for all citizens of the world, never just a privileged few.<br /><br /> As we unlock the secrets of the human genome, we must work simultaneously to ensure that new discoveries never pry open the doors of privacy. And we must guarantee that genetic information cannot be used to stigmatize or discriminate against any individual or group.<br /><br /> Increasing knowledge of the human genome must never change the basic belief on which our ethics, our government, our society are founded. All of us are created equal, entitled to equal treatment under the law. After all, I believe one of the great truths to emerge from this triumphant expedition inside the human genome is that in genetic terms, all human beings, regardless of race, are more than 99.9 percent the same.<br /><br /> What that means is that modern science has confirmed what we first learned from ancient fates. The most important fact of life on this Earth is our common humanity. My greatest wish on this day for the ages is that this incandescent truth will always guide our actions as we continue to march forth in this, the greatest age of discovery ever known.<br /><br /> Now, it is my great pleasure to turn to my friend, Prime Minister Tony Blair, who is joined in the State Dining Room at 10 Downing Street by Dr. Fred Sanger and other world-renowned scientists. With the generous support of the Wellcome Trust, British scientists have played an invaluable role in reaching this milestone.<br /><br /> On behalf of the American people, I would like to thank the Prime Minister, the scientists, and the British nation for the brilliant work you have brought to this international effort.<br /><br /> And, Mr. Prime Minister, I would like to salute not only your unwavering support for genome research, but also your visionary commitment to sparking ever-greater innovation across the full spectrum of science and technology.<br /><br /> And, on a personal note, I can't help but think that the year of your son's birth will always be remembered for the remarkable achievements we announce today. I think his life expectancy has just gone up by about 25 years. (Laughter.)<br /><br /> PRIME MINISTER BLAIR: Well, thank you very much, President Clinton; Bill. It's a great pleasure to join you, and I think of my little boy, Leo, growing up and learning and knowing things that his grandfather, after whom he was named, could not even have dreamt of. And when you contemplate that, it's almost not like different generations, but different eras of human existence. And there are enormous possibilities for him and his generation, but also some dangers, and our job is to try and develop the possibilities and thwart the dangers.<br /><br /> Thank you also, Ambassadors and distinguished guests, for being with us here in London on this momentous day. And as we have this link, can I not for the first time, thank President Clinton for his role in a different topic, the Northern Ireland peace process. He's been an absolutely unstinting friend to me and to the process of peace in Northern Ireland. And as we continue progress with another important step forward today, I want, if I can, Bill, to underline our gratitude for your enormous contribution to that process. Thank you. (Applause.)<br /><br /> I would also like to pay tribute to President Clinton's support for the Human Genome Project, and for the huge role the United States has played in it. As befits an undertaking that can benefit the whole of humankind, this project has also brought together the best of the global scientific community. Many of the giants of our generation have been involved. Nobel prize-winners, like Fred Sanger and Max Peruts, who are here with me today, thank you for all that you have done.<br /><br /> Scientists from Japan and Germany, France, China, and around the world have been involved, as well as the U.K. and the U.S. And this undertaking, therefore, has brought together the public, private and non-profit sectors in an unprecedented international partnership. In particular, I would like to single out the Wellcome Trust, without whose vision and foresight, Britain's 30-percent contribution to the overall result would not have been possible. And I would like, too, to mention the imaginative work of Celera and Dr. Craig Venter, who in the best spirit of scientific competition, has helped accelerate today's achievement.<br /><br /> For let us be in no doubt about what we are witnessing today -- a revolution in medical science whose implications far surpass even the discovery of antibiotics, the first great technological triumph of the 21st century. And every so often in the history of human endeavor there comes a breakthrough that takes humankind across a frontier and into a new era. And like President Clinton, I believe that today's announcement is such a breakthrough -- a breakthrough that opens the way for massive advances in the treatment of cancer and hereditary diseases, and that is only the beginning.<br /><br /> Ever since Francis Crick and Jim Watson and other great Anglo-American scientific partnership made their historic discovery in the middle of the last century, we've known that DNA was the code to life on Earth. And yet, I guess for Crick and Watson, the process of identifying the billions of units of DNA and piecing them together to form a working blueprint of the human race must have seemed almost a superhuman task, beyond the reach of their generation. And yet, today, it is all but complete.<br /><br /> Nothing better demonstrates the way technology and science are driving us, fast-forwarding us all into the future. But with the power of this discovery comes, of course, the responsibility to use it wisely. As with the greatest scientific achievements, the ethical and the moral questions raised by this astonishing breakthrough are profound. We, all of us, share a duty to ensure that the common property of the human genome is used freely for the common good of the whole human race; to ensure that the powerful information now at our disposal is used to transform medicine, not abused, to make man his own creator or invade individual privacy.<br /><br /> For most of us, today's developments are almost too awesome fully to comprehend. They underline the extraordinary scale of economic, technological, scientific change that sweeps across the modern world. I'm proud that Britain has played, with others, a pioneering role in that. But I believe it says something very important about the process of change. We cannot resist change, but our job, indeed our duty, is to make sense of change, to help people through it, to seize the massive opportunities for better health and a better quality of life; and then, with equal vigor, to minimize the threats such developments pose.<br /><br /> The scientists have presented us with that opportunity that now we, all of us, accept the responsibility to make these advances work for all our people in all our countries for the common good of all humankind.<br /><br /> So, Bill, I believe that this underlines the fact that we do, indeed, as we've often said together, live in a global community, and the importance now of working across national frontiers to safeguard our shared values and put this remarkable scientific achievement at the service of all humankind. (Applause.)<br /><br /> THE PRESIDENT: Tony, if I could, I would like to pick up on your last remark. I think everybody genuinely is concerned about the issues you raised, the privacy issues, and the whole general set of ethical, social and legal issues.<br /><br /> And it strikes me that our scientists -- the British and the American scientists, our French, German, Chinese counterparts who worked on this -- were working toward a single, clearly-defined goal in all those countries and in the other countries of the world that will have to live with both the benefits and the challenges of these discoveries.<br /><br /> There are different legal systems, different social mores, but I think that it would be a very good thing if the U.S, the U.K., and anybody else that wants to work with us, could have the same sort of joint endeavor we've had with the Human Genome, to deal with the implications of this; to deal with the legal, the social, the ethical implications. We may have differences from country to country, but I think that, if we work together, we'll give a higher sense of urgency to the project, and we'll get a better product.<br /><br /> And so I'm offering you another partnership. It's easy for me to do, because you'll have to do it, and I'll be gone. (Laughter.)<br /><br /> PRIME MINISTER BLAIR: Well, Bill, I entirely agree with that. And I think the fascinating possibilities of this scientific breakthrough is that it gives us a chance to do so much for our people, but it will raise really difficult ethical and moral and legal questions.<br /><br /> And the decision for us really as humanity is whether we are going to engage in the right cooperation across national frontiers so that we shape our destiny in a way that genuinely does benefit all our people, that makes the most of the possibilities, and faces up to the challenges and the dangers that it poses. And in a way, I think that the scientists that have been involved in this great undertaking have shown the spirit of cooperation that should now motivate the governments in taking this forward another step. They have given us this opportunity that we, all of us, are going to have a common responsibility in using it in the right way.<br /><br /> So as we now go to join our separate events on either side of the Atlantic, I think and believe that that spirit of cooperation, along with the scientific achievement, is something that we can all celebrate. And I'm, once again, proud to have taken part in this event with you, Bill. And all the very best to you and all your team for the work that you've done.<br /><br /> THE PRESIDENT: Thank you. (Applause.) Thank you very much, Tony.<br /><br /> Now, in a few moments, we'll hear from Celera President, Dr. Craig Venter, who shares in the glory of this day, and deservedly so because of his truly visionary pursuit of innovative strategies to sequence the human genome as rapidly as possible. And I thank you, Craig, for what you have done to make this day possible.<br /><br /> And now I'd like to invite Dr. Francis Collins to the lectern. I also want to congratulate him. From his development of some of the central methods for finding human disease genes, to his successful application of those methods, to the discovery of the cystic fibrosis gene in 1989, to his current leadership for the International Human Genome Project, he has combined the talents of rigorous science and a profound sensitivity to ethical, legal and social issues. He is a physician scientist of great faith, compassion, energy and integrity. And he has truly helped us, more than anyone else, to understand how the marvels of genome science will actually improve human health.<br /><br /> So Dr. Collins, please come up to the lectern. (Applause.)<br /><br /> DR. COLLINS: Mr. President, distinguished Ambassadors, ladies and gentlemen. It is truly a humble -- humbling and profound experience to be asked to speak here this morning. First of all, I would like to thank, most sincerely, President Clinton for his remarkable leadership in getting us to this point.<br /><br /> His strong and consistent voice for the importance of innovative science and its responsible uses to better the human condition has been an inspiration to all of us. He knows that genomics is one of the truly interdisciplinary fields of science requiring vigorous and creative involvement from physics, chemistry, engineering, computer science and biology.<br /><br /> I have also had the privilege to witness time and again the President's personal conviction that we must apply just as much energy and attention to solving the ethical, legal and social issues as we do to the bench research, and you saw that demonstrated again a few moments ago. His effective leadership in this area has moved us substantially closer to the time when no American need fear that information about their genome will be used against them.<br /><br /> Science is a voyage of exploration into the unknown. We are here today to celebrate a milestone along a truly unprecedented voyage, this one into ourselves. Alexander Pope wrote, "Know then thyself. Presume not God to scan. The proper study of mankind is man." What more powerful form of study of mankind could there be than to read our own instruction book?<br /><br /> I've been privileged over the last seven years to lead an international team of more than a thousand of some of the best and brightest scientists of our current generation, some of them here in this room, who have been truly dedicated to this goal. Today, we celebrate the revelation of the first draft of the human book of life.<br /><br /> Now, this milestone could only have come about with the happy combination of vision, determination, creative innovation and teamwork, and we stand on many shoulders here today. Beginning 15 years ago, leaders in the Department of Energy, the National Academy of Sciences and the National Institutes of Health, began to dream this dream.<br /><br /> At first, many thought it unrealistic and unattainable; yet, inspired by visionaries such as James Watson, who is here with us this morning, creative geniuses, such as Waterston, Sulston, Lander, Branscomb, Gibbs and many others here with us this morning, entered the fray. The vigorous involvement of talented colleagues in other countries, now including China, France, Germany, Japan and the United Kingdom, have made this project particularly gratifying to me. I would also like to recognize, publicly, the dedicated leadership of my friend and colleague, Ari Patrinos, of the Department of Energy, in moving this project forward so effectively here in the U.S.<br /><br /> Surely, the human genome is our shared inheritance, and it is fitting and proper that we are all working on it together. Now, thus far, every milestone set by the International Human Genome Project has been met -- on schedule or in some cases, ahead of schedule.<br /><br /> Today, we deliver, ahead of schedule again, the most visible and spectacular milestone of all. Most of the sequencing of the human genome by this international consortium has been done in just the last 15 months. During that time, this consortium has developed the capacity to sequence 1,000 letters of the DNA code per second, seven days a week, 24 hours a day. We have developed a map of overlapping fragments that includes 97 percent of the human genome, and we have sequenced 85 percent of this.<br /><br /> The sequence data is of higher quality than expected with half of it in finished or near-finished form. And all of this information has been placed in public databases every 24 hours, where any scientist with an Internet connection can use it to help unravel the mysteries of human biology. Already, more than a dozen genes, responsible for diseases from deafness to kidney disease to cancer, have been identified using this resource just in the last year.<br /><br /> So there is much to celebrate. But I have to tell you that this morning is also a bitter-sweet experience for me, personally. Less than 24 hours ago, I attended the funeral of my beloved sister-in-law, a wonderful marionette artist who brought magic and joy to thousands of children with her art. She died much too soon of breast cancer. The hope and promise of understanding all of the genes in the genome and applying this knowledge to the development of powerful new tools came just too late for her.<br /><br /> I think I speak for all of us in this room, and for the millions of others who have come to believe in the remarkable promise of biomedical research, that we must redouble our efforts to speed the application of these profound and fundamental observations about the human genome to the cure of disease. That most desirable of all outcomes will only come about with a continued powerful and dedicated partnership between basic science investigators and academia, and their colleagues in the biotechnology and pharmaceutical industries.<br /><br /> As the President has said, we still have much to do. Many tasks lie ahead if we are to learn how to speak the language of the genome fluently. Today is most certainly not the end of genomics, but perhaps it's the end of the beginning. Together we must develop the advances in medicine that are the real reason for doing this work. And with just as much vigor, we must provide the protections against potential misuses of genetic information. If there is anyone within the sound of my voice who has not seen that as a priority, I hope today's announcement is the necessary wake-up call.<br /><br /> It's a happy day for the world. It is humbling for me and awe-inspiring to realize that we have caught the first glimpse of our own instruction book, previously known only to God. What a profound responsibility it is to do this work. Historians will consider this a turning point. Researchers in a few years will have trouble imagining how we studied human biology without the genome sequence in front of us.<br /><br /> I particularly welcome the opportunity to celebrate this moment jointly with our scientific colleagues at Celera Genomics, and I wish to express my personal gratitude to Dr. Craig Venter for his openness in the cooperative planning process that led to this joint announcement. I congratulate him and his team on the work done at Celera, which uses an elegant and innovative strategy that is highly complementary to the approach taken by the public project. Much will be learned from a comparison of the two.<br /><br /> I'm happy that today, the only race we are talking about is the human race. (Applause.)<br /><br /> It is now my distinct pleasure to introduce to you Dr. J. Craig Venter, the President of Celera Genomics. Inspired by a life-changing experience as a medical corpsman in Vietnam, Craig charged into the field of human biology with remarkable energy and determination. Never satisfied with the status quo, always seeking new technology, inventing new approaches when the old ones wouldn't do, he has made profound contributions to the field of genomics.<br /><br /> His development of the expressed sequence tag, or EST, approach for sampling the expressed part of the genome, reduced to practice the notion of considering the human genome as a bounded, but ascertainable set of information. Just a few years later, he electrified the scientific community by publishing, with his colleague, Hamilton Smith, the complete sequence of a free-living organism, the bacterium hemophilus influenzae. And just three months ago, using the innovative whole genome shotgun approach he developed, and working with Gerry Rubin of the University of California at Berkeley, he and his colleagues published a sequence of the fruit fly, drosophila, another remarkable milestone in biology.<br /><br /> Articulate, provocative, and never complacent, he has ushered in a new way of thinking about biology. Now under his leadership, Celera Genomics has accomplished a remarkable goal, their own first assembly of the human genome sequence.<br /><br /> It is an honor and a pleasure the invite him to tell you about this landmark achievement. (Applause.)<br /><br /> DR. VENTER: I'm shorter than the previous two speakers. (Laughter.)<br /><br /> Mr. President, Mr. Prime Minister, members of the Cabinet, honorable members of Congress, ambassadors and distinguished guests. Today, June 26, in the year 2000, marks an historic point in the 100,000-year record of humanity. We're announcing today, for the first time our species can read the chemical letters of its genetic code.<br /><br /> At 12:30 p.m. today, at a joint press conference with the public genome effort, Celera Genomics will describe the first assembly of the human genetic code from the whole genome shotgun method. Starting only nine months ago, on September 8, 1999, 18 miles from the White House, a small team of scientists headed by myself, Hamilton Smith, Mark Adams, Gene Myers, and Granger Sutton, began sequencing the DNA of the human genome using a novel method pioneered by essentially the same team five years earlier at the Institute for Genomic Research.<br /><br /> The method used by Celera has determined the genetic code of five individuals. We have sequenced the genome of three females and two males, who have identified themselves has Hispanic, Asian, Caucasian, or African-American. We did this sampling not in an exclusionary way, but out of respect for the diversity that is America, and to help illustrate that the concept of race has no genetic or scientific basis.<br /><br /> In the five Celera genomes, there is no way to tell one ethnicity from another. Society and medicine treats us all as members of populations, where as individuals we are all unique, and population statistics do not apply.<br /><br /> I would like to acknowledge and congratulate Francis Collins and our colleagues in the public genome effort in the U.S., Europe and Asia, for their tremendous effort in generating a working draft of the human genome. I'd also like to personally thank Francis for his direct actions in working with me to foster cooperation in the genome community, and to shift our collective focus to this historic moment and its future impact on humanity. I would also like to thank the President for his commitment to public-private cooperation, and for making this day even more an historic event.<br /><br /> Obviously, our achievements would not have been possible without the efforts of the thousands of scientists around the world who have gone before us in the quest to better understand life at its most basic level. The beauty of science is that all-important discoveries are made by building on the discoveries of others. I continue to be inspired by the work of the pioneering men and women in the broad array of disciplines that had been brought together to enable this great accomplishment.<br /><br /> I would like to particularly acknowledge Charles DeLisi from the Department of Energy, and Jim Watson from Cold Spring Harbor, both here, for their vision in helping to initiate the Genome Project. The completion of the human genetic blueprint would not have possible without the continued investment of the U.S. Government and basic research. I applaud the President's efforts and the work of Congress during the last several years in producing the largest funding increases to fuel the engines of basic science.<br /><br /> At the same time, we could not overlook the investment of the private sector in research in America. There would be no announcement today if it were not for the more than $1 billion that P.E. Biosystems invested in Celera, and into the development of the automated DNA sequencer that both Celera and the public effort used to sequence the genome. In turn, some of the investment was driven by the public investment in science.<br /><br /> Thirty-three years ago, as a young man serving in the medical corps in Vietnam, I learned firsthand how tenuous our hold on life can be. That experience inspired my interest in learning how the trillions of cells in our bodies interact to create and sustain life. When I witnessed firsthand that some men live through devastating trauma to their bodies, while others died after giving up from seemingly small wounds, I realized that the human spirit was at least as important as our physiology.<br /><br /> We're clearly much, much more than the sum total of our genes, just as our society is greater than the sum total of each of us. Our physiology is based on complex and seemingly infinite interactions amongst all our genes and the environment, just as our civilization is based on the interactions amongst all of us.<br /><br /> One of the wonderful discoveries that my colleagues and I have made while decoding the DNA of over two dozen species, from viruses to bacteria to plants to insects, and now human beings, is that we're all connected to the commonality of the genetic code in evolution. When life is reduced to its very essence, we find that we have many genes in common with every species on Earth, and that we're not so different from one another.<br /><br /> You may be surprised to learn that your sequencers are greater than 90 percent identical to proteins in other animals. It's my belief that the basic knowledge that we're providing the world will have a profound impact on the human condition and the treatments for disease, and our view on our place in the biological continuum.<br /><br /> The genome sequence represents a new starting point for science and medicine, with potential impact on every disease. Taking the example, cancer, each day approximately 2,000 die in America from cancer. As a consequence of the genome efforts that you've heard described by Dr. Collins and myself this morning, and the research that will be catalyzed by this information, there's at least the potential to reduce the number of cancer deaths to zero during our lifetimes. The development of new therapeutics will require continued public investment in basic science, and the translations of discoveries into new medicine by the biotechs and pharmaceutical industry.<br /><br /> However, I am concerned, as many of you are, that there are some who will want to use this new knowledge as a basis of discrimination. A CNN-Time poll this morning reported that 46 percent of Americans polled believe that the impact of the Human Genome Project will be negative. We must work together toward higher science literacy and the wise use of our common heritage.<br /><br /> I know from personal discussions with the President over the past several years, and his comments here this morning, that genetic discrimination has been one of his major concerns about the impact of the genomic revolution. While those who will base social decisions on genetic reductionism will be ultimately defeated by science, new laws to protect us from genetic discrimination are critical in order to maximize the medical benefits from genome discoveries.<br /><br /> Some have said to me that sequencing the human genome will diminish humanity by taking the mystery out of life. Poets have argued that genome sequencing is an example of sterilizing reductionism that will rob them of their inspiration. Nothing could be further from the truth. The complexities and wonder of how the inanimate chemicals that are our genetic code give rise to the imponderables of the human spirit should keep poets and philosophers inspired for the millenniums.<br /><br /> Thank you. (Applause.)<br /><br /> THE PRESIDENT: Well, thank you both for those remarkable statements. I suppose, in closing, the most important thing I could do is to associate myself with Dr. Venter's last statement. When we get this all worked out and we're all living to be 150 -- (laughter) -- young people will still fall in love, old people will still fight about things that should have been resolved 50 years ago -- (laughter) -- we will all, on occasion, do stupid things, and we will all see the unbelievable capacity of humanity to be noble. This is a great day.<br /><br /> Thank you very much. (Applause.)<br /><br /> END 10:50 A.M. EDT <br /><br /></BLOCKQUOTE></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-86108767534121492692010-04-09T09:37:00.008+02:002010-04-09T10:14:50.283+02:00El Frau científic també arriba al PDB<div style="text-align: justify;">El <a href="http://en.wikipedia.org/wiki/Scientific_misconduct" target="_blank" title="wikiFrau">frau científic</a> és una d'aquelles coses que fa molt de mal a la ciència i a la comunitat científica i que a vegades és difícil de detectar. Com a frau científic podem entendre <a title="frau" target="_blank" href="http://www.infodoctor.org/rafabravo/fraude.htm">diferents coses</a>, com la invenció dels resultats, la falsificació o manipulació de les dades o el plagi. En l'article "<a href="http://www.sebbm.com/pdf/156/d03156.pdf">Historia reciente del fraude en la investigación biomédica</a>" d'en Xavier Bosch, publicat al <a href="http://www.sebbm.com/156.htm">número 156</a> de la revista de la <a href="http://www.sebbm.es/">Sociedad Española de Bioquímica y Biología Molecular</a> trobareu una descripció d'alguns dels casos més recents de frau en la investigació biomèdica en general. En aquest <a href="http://www.thesmokesellers.com/?p=571" target="_blank" title="BlogFrau">blog</a> trobareu el que consideren com els 10 casos de frau més importants. Quins poden ser els motius per què alguns científics cometen fraus? Guanyar prestigi o reconeixement o el fet d'inventar-se resultats que beneficien a alguna empresa (inventar-se o exagerar els efectes beneficiosos d'un fàrmac, per exemple) podrien ser algunes de les causes. Per aquest motiu, molts dels articles científics tenen una secció anomenada "<span style="font-style: italic;">Conflic of interests</span>" o "<span style="font-style: italic;">Competing interests</span>" on els autors han d'esmentar per exemple si han rebut finançament d'una empresa per fer l'estudi que presenten.<br /><br />Quan es demostra un cas de frau científic o hi ha dubtes sobre la veracitat d'uns resultats, la revista en la que es va publicar pot demanar als autors que es retractin de l'article o articles fraudulents o poden fer-ho ells mateixos. Aquests articles apareixen en les bases de dades sota la categoria de "<a title="PubMedRetraction" target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=%22retracted%20publication%22%5BPublication%20Type%5D%20OR%20%22retracted%20publication%22%5BAll%20Fields%5D&cmd=DetailsSearch">Retracted Publication</a>". Veieu alguns exemples:<br /> <ul><li>En aquest <a href="http://www.pnas.org/content/95/20/12069.1.full" target="_blank" title="RetractacioPNAS">cas</a> els mateixos autors es retracten d'alguns dels seus resultats anteriors en dos revistes, per falta de reprodubilitat dels seus resultats (No tindria perquè tractar-se d'un frau, podria ser també un cas d'error).</li><br /> <li>En aquest altre <a href="http://www.nature.com/ncb/journal/v9/n4/full/ncb1584.html" target="_blank" title="RetNatCelBiol">cas</a> és l'editorial de la revista que manifesta que un dels autors va manipular les imatges de l'article.</li></ul><br />En el cas de les bases de dades que contenen informació biològica, el procés de retractació fins ara no ha estat gaire corrent, potser perquè no s'havia previst que podia donar-se algun cas. Els casos han començat a sortir, però la reacció d'algunes de les bases de dades no ha estat prou ràpida. Aquest és el cas de 11 estructures de proteïnes de la base de dades <a href="http://www.pdb.org/pdb/home/home.do">PDB</a>. Tot i que a l'agost del 2009 en un <a href="http://main.uab.edu/Sites/reporter/articles/71570/">comunicat de premsa</a> la <span style="font-style:italic;">University of Alabama at Birmingham</span> va manifestar els dubtes sobre els resultats d'una de les seves treballadores, que diferents <a href="http://www.biotechniques.com/news/Fraudulent-database-entries-raise-questions-about-protocol/biotechniques-184802.html">mitjans</a> van difondre la notícia i que la <a href="http://www.pnas.org/content/107/14/6551.3.full?sid=3a716812-f608-4ed7-9825-fbeb0dcd1f61">revista PNAS en una editorial</a> posa en dubte dos dels seus articles, a dia d'avui (9 d'abril del 2010), 10 d'aquestes estructures encara estan a la base de dades del PDB, sense cap nota de que podrien ser estructures inventades. Sembla ser que la política per retirar una estructura d'aquesta base de dades és que es substitueixi per una estructura millor, o que es retiri per què l'article on es descriu hagi estat retractat per la revista a on es va publicar. En el cas que ens ocupa, només 1 dels articles ha estat retractat i només 1 de les estructures ha estat retirada. La retractació d'un article pot ser un procés llarg i crec que les bases de dades no poden esperar tant, si cal s'han de canviar les normes, no creieu? </div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-18074647015065467532010-04-07T20:39:00.005+02:002010-04-07T20:55:41.424+02:00Nature Supplement on visualizing biological data<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.nature.com/nmeth/journal/v7/n3s/images/nmeth0310-S1-I1.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 150px;" src="http://www.nature.com/nmeth/journal/v7/n3s/images/nmeth0310-S1-I1.jpg" border="0" alt="" /></a>Diuen que una imatge val més que mil paraules. Aquest mes la revista <span style="font-style:italic;"><a href="http://www.nature.com/nmeth/index.html">Nature methods</a></span> publica un <a href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth0310-S1.html">suplement on-line sobre visualització de dades biològiques</a>. Molt recomanable. Aquí teniu els links:<br /><font size=2><h3 class="subject">Foreword</h3><div class="spacing"><div><h4 class="atl" id="nmeth0310-S1">Supplement on visualizing biological data <span class="hidden">- </span><span class="page"><abbr title="page">p</abbr>S1</span></h4><div class="aug">Daniel Evanko</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth0310-S1</span></div><div class="articlelinks"><a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth0310-S1.html">Full Text<span class="hidden"> - Supplement on visualizing biological data</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth0310-S1.pdf"><abbr title="Portable Document Format">PDF</abbr> (188 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Supplement on visualizing biological data</span></a></div></div></div><hr class="separator" /> <div class="subject" id="cy"><a class="backtotop" href="http://www.nature.com/nmeth/journal/v7/n3s/index.html#top"><br /><br /><span class="hidden"></span></a><h3 class="subject">Commentary</h3><div class="spacing"><div><h4 class="atl" id="nmeth.f.301">Visualizing biological data—now and in the future <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S2 - S4</span></h4><div class="aug">Seán I O'Donoghue, Anne-Claude Gavin, Nils Gehlenborg, David S Goodsell, Jean-Karim Hériché, Cydney B Nielsen, Chris North, Arthur J Olson, James B Procter, David W Shattuck, Thomas Walter & Bang Wong</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.f.301</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.f.301.html">Abstract<span class="hidden"> - Visualizing biological data[mdash]now and in the future</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.f.301.html">Full Text<span class="hidden"> - Visualizing biological data—now and in the future</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.f.301.pdf"><abbr title="Portable Document Format">PDF</abbr> (336 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualizing biological data—now and in the future</span></a></div></div></div><hr class="separator" /> </div><a class="backtotop" href="http://www.nature.com/nmeth/journal/v7/n3s/index.html#top"><br /><br /><span class="hidden"></span></a><h3 class="subject">Reviews</h3><div class="spacing"><div><h4 class="atl" id="nmeth.1422">Visualizing genomes: techniques and challenges <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S5 - S15</span></h4><div class="aug">Cydney B Nielsen, Michael Cantor, Inna Dubchak, David Gordon & Ting Wang</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.1422</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.1422.html">Abstract<span class="hidden"> - Visualizing genomes: techniques and challenges</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.1422.html">Full Text<span class="hidden"> - Visualizing genomes: techniques and challenges</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.1422.pdf"><abbr title="Portable Document Format">PDF</abbr> (993 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualizing genomes: techniques and challenges</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/suppinfo/nmeth.1422_S1.html" title="Supplementary information: Visualizing genomes: techniques and challenges">Supplementary information</a> </div></div></div><hr class="separator" /> <!-- 300x250 ad --> <div class="ad ad300x250"><br /><div><h4 class="atl" id="nmeth.1434"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.nature.com/nmeth/journal/v7/n3s/thumbs/nmeth.1434-F2.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 150px; height: 81px;" src="http://www.nature.com/nmeth/journal/v7/n3s/thumbs/nmeth.1434-F2.jpg" border="0" alt="" /></a>Visualization of multiple alignments, phylogenies and gene family evolution <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S16 - S25</span></h4><div class="aug">James B Procter, Julie Thompson, Ivica Letunic, Chris Creevey, Fabrice Jossinet & Geoffrey J Barton</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.1434</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.1434.html">Abstract<span class="hidden"> - Visualization of multiple alignments, phylogenies and gene family evolution</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.1434.html">Full Text<span class="hidden"> - Visualization of multiple alignments, phylogenies and gene family evolution</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.1434.pdf"><abbr title="Portable Document Format">PDF</abbr> (867 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualization of multiple alignments, phylogenies and gene family evolution</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/suppinfo/nmeth.1434_S1.html" title="Supplementary information: Visualization of multiple alignments, phylogenies and gene family evolution">Supplementary information</a> </div></div></div><hr class="separator" /> <div class="spacing"><div><h4 class="atl" id="nmeth.1431">Visualization of image data from cells to organisms <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S26 - S41</span></h4><div class="aug">Thomas Walter, David W Shattuck, Richard Baldock, Mark E Bastin, Anne E Carpenter, Suzanne Duce, Jan Ellenberg, Adam Fraser, Nicholas Hamilton, Steve Pieper, Mark A Ragan, Jurgen E Schneider, Pavel Tomancak & Jean-Karim Hériché</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.1431</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.1431.html">Abstract<span class="hidden"> - Visualization of image data from cells to organisms</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.1431.html">Full Text<span class="hidden"> - Visualization of image data from cells to organisms</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.1431.pdf"><abbr title="Portable Document Format">PDF</abbr> (1,682 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualization of image data from cells to organisms</span></a></div></div></div><hr class="separator" /> <div class="spacing"><div><h4 class="atl" id="nmeth.1427">Visualization of macromolecular structures <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S42 - S55</span></h4><div class="aug">Seán I O'Donoghue, David S Goodsell, Achilleas S Frangakis, Fabrice Jossinet, Roman A Laskowski, Michael Nilges, Helen R Saibil, Andrea Schafferhans, Rebecca C Wade, Eric Westhof & Arthur J Olson</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.1427</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.1427.html">Abstract<span class="hidden"> - Visualization of macromolecular structures</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.1427.html">Full Text<span class="hidden"> - Visualization of macromolecular structures</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.1427.pdf"><abbr title="Portable Document Format">PDF</abbr> (2,317 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualization of macromolecular structures</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/suppinfo/nmeth.1427_S1.html" title="Supplementary information: Visualization of macromolecular structures">Supplementary information</a> </div></div></div><hr class="separator" /> <div class="spacing"><div><h4 class="atl" id="nmeth.1436">Visualization of omics data for systems biology <span class="hidden">- </span><span class="page"><abbr title="pages">pp</abbr>S56 - S68</span></h4><div class="aug">Nils Gehlenborg, Seán I O'Donoghue, Nitin S Baliga, Alexander Goesmann, Matthew A Hibbs, Hiroaki Kitano, Oliver Kohlbacher, Heiko Neuweger, Reinhard Schneider, Dan Tenenbaum & Anne-Claude Gavin</div><div class="doi"><span class="doi"><abbr title="Digital Object Identifier">doi</abbr>:10.1038/nmeth.1436</span></div><div class="articlelinks"><a href="http://www.nature.com/nmeth/journal/v7/n3s/abs/nmeth.1436.html">Abstract<span class="hidden"> - Visualization of omics data for systems biology</span></a> | <a class="fulltext" href="http://www.nature.com/nmeth/journal/v7/n3s/full/nmeth.1436.html">Full Text<span class="hidden"> - Visualization of omics data for systems biology</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/pdf/nmeth.1436.pdf"><abbr title="Portable Document Format">PDF</abbr> (1,469 <abbr title="Kilobyte">KB</abbr>)<span class="hidden"> - Visualization of omics data for systems biology</span></a> | <a href="http://www.nature.com/nmeth/journal/v7/n3s/suppinfo/nmeth.1436_S1.html" title="Supplementary information: Visualization of omics data for systems biology">Supplementary information</a> </div></div></div></font></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-10488540306108633852010-03-21T12:30:00.011+01:002010-03-21T13:15:16.123+01:00La historia de l'ós polar<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.cbc.ca/gfx/images/news/topstories/2010/03/01/tp-polar-bear-dna.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 306px; height: 172px;" src="http://www.cbc.ca/gfx/images/news/topstories/2010/03/01/tp-polar-bear-dna.jpg" border="0" alt="" /></a>Aquests dies és notícia la recent seqüenciació del DNA mitocondrial d'un ós polar (<span style="font-style:italic;"><a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=29073">Ursus maritimus</a></span>). La <a href="http://www.biotechniques.com/news/Researchers-sequence-complete-mitochondrial-genome-of-ancient-polar-bear/biotechniques-208442.html">notícia</a> no tindria tanta repercussió si no fos pel fet que el DNA es va extreure d'una mandíbula parcialment fossilitzada trobada a Noruega al 2004 i d'una antiguitat de 110.000–130.000 anys.<br /><br />Segons el <a href="http://www.science.psu.edu/news-and-events/2010-news/Schuster2-2010">comunicat de premsa de l'equip investigador</a>, es tracta de la seqüència de <a href="http://ca.wikipedia.org/wiki/ADN_mitocondrial">DNA mitocondrial</a> més antiga d'un mamífer que s'ha seqüenciat fins al moment. La seqüenciació del DNA mitocondrial es descriu en l'<a href="http://www.pnas.org/content/early/2010/02/18/0914266107.abstract">article publicat a la revista <span style="font-style:italic;">Proceedings of the National Academy of Sciences</span> (PNAS)</a> i posa de manifest que l'ós polar és una espècie relativament recent (va divergir fa uns 150.000 anys de l'actual <a href="http://ca.wikipedia.org/wiki/%C3%93s_bru">ós bru</a>) que es va adaptar molt ràpidament a l'entorn de l'àrtic. Es podrà adaptar aquesta espècie al canvi climàtic causat per la humanitat? Esperem que aquesta seqüència de DNA no passi a ser una seqüència d'una <a href="http://vallve.blogspot.com/2008/09/dna-despcies-extingides.html">espècie extingida</a>.</div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com0tag:blogger.com,1999:blog-2335515041863838416.post-32756368171615474912010-03-04T15:39:00.005+01:002010-03-04T15:56:13.378+01:00Com definirieu Ciència?<div style="text-align: justify;">Tot i que aquest vídeo el podeu trobar en altres <a href="http://lacomunidad.elpais.com/apuntes-cientificos-desde-el-mit/2010/3/1/la-sinfonia-la-ciencia-intuicion-vs-racionalizacion">blogs</a>, el meu primer impuls ha estat penjar-lo també aquí. Es tracta d'un dels vídeos creats en la iniciativa anomenada "<span style="font-style:italic;"><a href="http://www.symphonyofscience.com/">Symphony of Science</a></span>".<br /><br /><br /><center><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/qfHQ06gomr4&hl=en_US&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/qfHQ06gomr4&hl=en_US&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /></center><br /><center><font size="1">[Michael Shermer]<br />Science is the best tool ever devised<br />For understanding how the world works<br /><br />[Jacob Bronowski]<br />Science is a very human form of knowledge<br />We are always at the brink of the known<br /><br />[Carl Sagan]<br />Science is a collaborative enterprise<br />Spanning the generations<br />We remember those who prepared the way<br />Seeing for them also<br /><br />[Neil deGrasse Tyson]<br />If you're scientifically literate,<br />The world looks very different to you<br />And that understanding empowers you<br /><br />Refrain:<br />[Richard Dawkins]<br />There's real poetry in the real world<br />Science is the poetry of reality<br /><br />[Sagan]<br />We can do science<br />And with it, we can improve our lives<br /><br />[Jill Tarter]<br />The story of humans is the story of ideas<br />That shine light into dark corners<br /><br />[Lawrence Krauss]<br />Scientists love mysteries<br />They love not knowing<br />[Richard Feynman]<br />I don't feel frightened by not knowing things<br />I think it's much more interesting<br /><br />[Brian Greene]<br />There's a larger universal reality<br />of which we are all a part<br /><br />[Stephen Hawking]<br />The further we probe into the universe<br />The more remarkable are the discoveries we make<br /><br />[Carolyn Porco]<br />The quest for the truth, in and of itself,<br />Is a story that's filled with insights<br /><br />(Refrain)<br /><br />[Greene]<br />From our lonely point in the cosmos<br />We have through the power of thought<br />Been able to peer back to a brief moment<br />After the beginning of the universe<br /><br />[PZ Myers]<br />I think that science changes the way your mind works<br />To think a little more deeply about things<br /><br />[Dawkins]<br />Science replaces private predjudice<br />With publicly verifiable evidence<br />(Refrain)<br /></font></center><br /><br />Altres vídeos de <span style="font-style:italic;">Symphony of Science</span>:<br /><ul><li><a href="http://www.youtube.com/watch?v=nrj6BNeQ">The Unbroken Thread</a><br /><li><a href="http://www.youtube.com/watch?v=x3l1yFvg1k4">Our Place in the Cosmos</a><br /><li><a href="http://www.youtube.com/watch?v=y9vvOO7TSI8">We are all connected</a><br /><li><a href="http://www.youtube.com/watch?v=7hlsmyOT">A Glorious Dawn</a><br /></ul><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com3tag:blogger.com,1999:blog-2335515041863838416.post-72766237947409249902010-02-18T20:43:00.013+01:002010-02-18T21:58:02.460+01:00L'ADN de Tutankamon<div style="text-align: justify;">Aquests dies és notícia <a href="http://ca.wikipedia.org/wiki/Tutankamon">Tutankamon</a> i les anàlisis de DNA que s'han fet per determinar la causa de la seva mort i establir les relacions genealògiques entre diverses mòmies. Els titulars dels articles dels diaris així ho reflexen. Per exemple: "<a href="http://www.lavanguardia.es/ciudadanos/noticias/20100216/53893407330/el-adn-de-tutankamon-revela-que-murio-de-una-enfermedad-osea-relacionada-con-la-malaria.html">El ADN de Tutankamón revela que murió de una enfermedad ósea relacionada con la malaria</a>", "<a href="http://www.elpais.com/articulo/cultura/Nefertiti/era/madre/rey/elpepicul/20100218elpepicul_5/Tes?print=1">Nefertiti no era la madre del rey</a>" o "<a href="http://www.elpais.com/articulo/cultura/paludismo/contribuyo/muerte/Tutankamon/estudio/ADN/elpepucul/20100216elpepucul_11/Tes">El paludismo contribuyó a la muerte de Tutankamón, según un estudio de su ADN</a>".<br /><br />Els resultats dels anàlisis d'ADN ha portat sorpreses, com per exemple que els seus pares eren possiblement germans o que la seva mare no era Nefertiti, i ha permès obtenir una possible relació genealògica entre diverses mòmies: <br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovery.com/files/tree.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 481px; height: 368px;" src="http://blogs.discovery.com/files/tree.jpg" border="0" alt="" /></a><br /><br />Tot i que no hi ha cap novetat científica important en la notícia (no ha estat la primera mostra de <a href="http://vallve.blogspot.com/search/label/DNA%20antic">"DNA antic"</a> que s'ha extret i analitzat i per exemple la notícia recent de la <a href="http://albertinho-goblin77.blogspot.com/2010/02/sequenciat-un-esquimal-de-fa-4000-anys.html">seqüenciació del genoma humà d'un esquimal que va viure fa uns 4000 anys</a> era científicament més novedosa), penso que s'ha perdut una molt bona oportunitat per fer una mica de difusió científica. En les notícies s'esmenta que tot aquest nou coneixement ha estat gràcies a l'anàlisi del DNA, però de quina mena d'anàlisi parlen? Sembla que haguin extret el DNA de les mòmies (això sí que queda prou clar), l'haguin possat en un barret i oh màgia! tenim les relacions genealògiques de les mòmies. A veure si podem profunditzar una mica més:<br /><br />La clau per establir les relacions genealògiques ha estat l'estudi de les variacions que dins del genoma humà trobem entre diferents individus. En concret, s'han estudiat diverses variacions conegudes amb el nom de <a href="http://es.wikipedia.org/wiki/Microsat%C3%A9lites">microsatèl·lits</a>, que s'han utilitzat com a <a href="http://ca.wikipedia.org/wiki/Marcador_gen%C3%A8tic">marcadors genètics</a>. Podem definir un microsatèl·lit com una seqüència de DNA en les que un fragment, que pot anar des de 1 a 6 nucleòtids, es repeteix diverses vegades, de manera consecutiva. La variació del nombre de vegades que es repeteix pot variar entre individus i es pot utilitzar per establir si existeix una relació pare/mare-fill/a entre dos individus. Com que tenim 2 còpies de tots els cromosomes (un que heretem del pare i l'altre de la mare), el nombre de repeticions en un microsatèlit també l'hem heretat dels nostres progenitors, que el van heretar dels nostres avis, i així successivament. Per saber el nombre de repeticions que un individu té en un determinat microsatèl·lit només cal extreure una mostra de DNA (es pot treure d'un ós, pel, ...) i amplificar mitjançant una <a href="http://ca.wikipedia.org/wiki/Reacci%C3%B3_en_cadena_de_la_polimerasa">PCR</a> la regió que conté les repeticions, utilitzant uns o <a href="http://ca.wikipedia.org/wiki/Encebador">encebadors</a> <span style="font-style:italic;">primers</span>. <br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.ncbi.nlm.nih.gov/bookshelf/picrender.fcgi?book=cooper&part=A647&blobname=ch4f30.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 503px;" src="http://www.ncbi.nlm.nih.gov/bookshelf/picrender.fcgi?book=cooper&part=A647&blobname=ch4f30.jpg" border="0" alt="" /></a><br /><br />En el cas de Tutankamon s'han utilitzat 8 microsatèl·lits i en la figura següent podem veure el nombre de repeticions de cada mòmia en cada microsatèl·lit:<br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTVgRUEA5TT0I484NDMGPPF6kKEQ-Go-u8IgqTVzdpvTKwyQZvbmHp5P8PxC-pqZwtN4JRTh54hyphenhyphenbKkkPRjg3kGKzB1ogXLaxlxNwAwqQ-IZ-QE2KOW0YjHnaLGQWUfAsvbsL6EoSudd0/s1600-h/Micro.png"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 500px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTVgRUEA5TT0I484NDMGPPF6kKEQ-Go-u8IgqTVzdpvTKwyQZvbmHp5P8PxC-pqZwtN4JRTh54hyphenhyphenbKkkPRjg3kGKzB1ogXLaxlxNwAwqQ-IZ-QE2KOW0YjHnaLGQWUfAsvbsL6EoSudd0/s400/Micro.png" border="0" alt=""id="BLOGGER_PHOTO_ID_5439672127877797778" /></a><br /><br />Amb aquesta informació es pot fer una possible genealogia i establir que el pare de Tut (Akhenaten) i la seva mare (la mòmia KV35YL) possiblement eren germans:<br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSJoAQMhY-WsBVyyR3HgtkfRssh2mYfRhBjDxV9RNBk7P0-jQggr2SragmVFnNV3u0y9asW7hiHGNw0Eu7f3wufqzZHrvvzrECtSPmaKMaWBuN8_ITKfVqHJonCXUqcJyNlivmcZ__fik/s1600-h/pedigree.png"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 550px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSJoAQMhY-WsBVyyR3HgtkfRssh2mYfRhBjDxV9RNBk7P0-jQggr2SragmVFnNV3u0y9asW7hiHGNw0Eu7f3wufqzZHrvvzrECtSPmaKMaWBuN8_ITKfVqHJonCXUqcJyNlivmcZ__fik/s400/pedigree.png" border="0" alt=""id="BLOGGER_PHOTO_ID_5439671262059613362" /></a><br />El treball amb DNA antic es especialment dificultós. El DNA al cap dels anys es va trencant i el que s'obté són fragments petits, que dificulten l'assaig. Hi ha també el problema de la contaminació. Com es pot estar segur de que realment estem obtenint el DNA, en aquest cas de la mòmia, i no per exemple dels investigadors que fan l'anàlisi i que podrien haver contaminat la mostra. És per això que en aquest tipus d'anàlisi cal ser molt curós. Per a que un resultat segui creïble, cal repetir molts cops els assajos i comprovar que sempre surt el mateix. Normalment els assajos es fan simultàniament en dos laboratoris diferents, utilitzant investigadors diferents. Fins i tot cal analitzar el DNA dels investigadors per descartar contaminacions. <br /><br />Article original: Z. Hawass <span style="font-style:italic;">et al.</span> <a href="http://jama.ama-assn.org/cgi/content/abstract/303/7/638">Ancestry and Pathology in King Tutankhamun's Family.</a> JAMA. 2010;303(7):638-647.<br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-74254210207371976492009-12-18T16:26:00.004+01:002009-12-18T16:48:20.093+01:00Tanquem l'any Darwin amb regals ....<div style="text-align: justify;">Per acabar l'any Darwin algunes idees per fer un regal "evolutiu". N'hi ha per totes les edats i gustos. Bé, per tots els gustos (creacionistes o <a href="http://sandwalk.blogspot.com/2007/07/are-idiots-creationists.html">IDiots</a>) potser no. Extret de l'"<span style="font-style:italic;"><a href="http://www.cafepress.com/evolverzone">Evolver Zone</a></span>", <span style="font-style:italic;">a resource for students, teachers, and researchers with an interest in evolution.</span><br /><center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images2.cafepress.com/nocache/product/385070722v2147483647_150x150_Front.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 150px; height: 150px;" src="http://images2.cafepress.com/nocache/product/385070722v2147483647_150x150_Front.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images1.cafepress.com/product/385117991v0_350x350_Front_Color-BlueWhite.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images1.cafepress.com/product/385117991v0_350x350_Front_Color-BlueWhite.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images1.cafepress.com/product/385083441v0_350x350_Front_Color-White.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images1.cafepress.com/product/385083441v0_350x350_Front_Color-White.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images4.cafepress.com/product/385100994v0_350x350_Front_Color-Green.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images4.cafepress.com/product/385100994v0_350x350_Front_Color-Green.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images3.cafepress.com/product/385114873v0_350x350_Front_Color-White.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images3.cafepress.com/product/385114873v0_350x350_Front_Color-White.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images2.cafepress.com/product/385100832v0_350x350_Front_Color-White.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images2.cafepress.com/product/385100832v0_350x350_Front_Color-White.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images3.cafepress.com/product/385114663v0_350x350_Front_Color-BlackWhite.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images3.cafepress.com/product/385114663v0_350x350_Front_Color-BlackWhite.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images7.cafepress.com/product/385114357v0_350x350_Front_Color-White.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images7.cafepress.com/product/385114357v0_350x350_Front_Color-White.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images8.cafepress.com/product/385083558v0_350x350_Front_Color-White.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 350px; height: 350px;" src="http://images8.cafepress.com/product/385083558v0_350x350_Front_Color-White.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images2.cafepress.com/nocache/product/385081682v2147483647_150x150_Front.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 150px; height: 150px;" src="http://images2.cafepress.com/nocache/product/385081682v2147483647_150x150_Front.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://images5.cafepress.com/nocache/product/385070725v2147483647_150x150_Front.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 150px; height: 150px;" src="http://images5.cafepress.com/nocache/product/385070725v2147483647_150x150_Front.jpg" border="0" alt="" /></a></center></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com3tag:blogger.com,1999:blog-2335515041863838416.post-89328477242210498692009-12-12T08:00:00.002+01:002009-12-13T19:48:31.858+01:00Gadgets sobre Bioinformatica<table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4>Aquí van una serie de Gadgets sobre Bioinformàtica molt útils desenvolupats per <a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&Itemid=134">Your Lab Data</a>.<br /></h4><h4><br /></h4><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=dna2protein">DNA to Protein</a></h4></td> </tr> <tr> <td colspan="1"> Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.<br /></td></tr></tbody></table><br /><span style="text-decoration: underline;"><span style="font-weight: bold;"><br /></span></span><div id="remote_29" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://29.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/dna2protein.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=29&ifpctok=1138390018600474592&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_29" name="remote_iframe_29" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 415px;" scrolling="no" frameborder="0"><br></iframe></div><br /><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=seq_manipulation">Sequence Manipulation</a></h4></td> </tr> <tr> <td colspan="1">The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.</td></tr></tbody></table><div id="remote_30" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://30.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/sequence_manipulation.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=30&ifpctok=-8552215557965756014&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_30" name="remote_iframe_30" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 290px;" scrolling="no" frameborder="0"><br></iframe></div><br /><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=protein2dna">Protein to DNA</a></h4></td> </tr> <tr> <td colspan="1"> Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.<br /></td></tr></tbody></table><br /><div id="remote_31" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://31.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/protein2dna.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=31&ifpctok=4542576986970419848&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_31" name="remote_iframe_31" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 170px;" scrolling="no" frameborder="0"><br></iframe></div><br /><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=palindromic">Palindromic sequences finder</a></h4></td> </tr> <tr> <td colspan="1"> Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences.<br /></td></tr></tbody></table><div id="remote_33" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://33.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/palindromic_sequence_finder.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=33&ifpctok=1248835481670509268&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_33" name="remote_iframe_33" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 200px;" scrolling="no" frameborder="0"><br></iframe></div><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=digest">Restriction digest of DNA</a></h4></td> </tr> <tr> <td colspan="1">Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).<br /></td></tr></tbody></table><br /><table 300="" width="" align="center" border="0" cellpadding="0"><tbody><tr><td style="font-family: Verdana; font-size: 8pt; text-decoration: none;" valign="top" align="center"><b>Sequence:</b><br /><textarea rows="7" cols="40" name="sequence"> </textarea> </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="center"> <input value="Digest" type="submit"> <input checked="checked" value="1" name="showcode" type="checkbox"> Show code </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="center"> Min. recognition size for each enzyme <select name="minimum"> <option>4</option><option>5</option><option>6</option><option>7</option><option>8 </option></select> </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="center"> Type of restriction enzyme <select name="retype"> <option value="0">All</option><option value="1">Blunt ends</option><option value="2">Overhang end </option></select> </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="center"> Use only this endonuclease <select name="wre"> <option value="">Select </option><option>AarI </option><option>AasI </option><option>AatI </option><option>AatII </option><option>AbsI </option><option>AccI </option><option>AccII </option><option>AccIII </option><option>Acc16I </option><option>Acc36I </option><option>Acc65I </option><option>AccB1I </option><option>AccB7I </option><option>AccBSI </option><option>AciI </option><option>AclI </option><option>AclWI </option><option>AcoI </option><option>AcsI </option><option>AcuI </option><option>AcvI </option><option>AcyI </option><option>AdeI </option><option>AfaI </option><option>AfeI </option><option>AfiI </option><option>AflII </option><option>AflIII </option><option>AgeI </option><option>AhdI </option><option>AhlI </option><option>AjiI </option><option>AjnI </option><option>AjuI </option><option>AleI </option><option>AlfI </option><option>AloI </option><option>AluI </option><option>AluBI </option><option>AlwI </option><option>Alw21I </option><option>Alw26I </option><option>Alw44I </option><option>AlwNI </option><option>Ama87I </option><option>Aor13HI </option><option>Aor51HI </option><option>ApaI </option><option>ApaLI </option><option>ApeKI </option><option>ApoI </option><option>AscI </option><option>AseI </option><option>AsiGI </option><option>AsiSI </option><option>AspI </option><option>Asp700I </option><option>Asp718I </option><option>AspA2I </option><option>AspEI </option><option>AspLEI </option><option>AspS9I </option><option>AssI </option><option>AsuC2I </option><option>AsuHPI </option><option>AsuNHI </option><option>AvaI </option><option>AvaII </option><option>AviII </option><option>AvrII </option><option>AxyI </option><option>BaeI </option><option>BalI </option><option>BamHI </option><option>BanI </option><option>BanII </option><option>BanIII </option><option>BarI </option><option>BasI </option><option>BauI </option><option>BbeI </option><option>BbrPI </option><option>BbsI </option><option>BbuI </option><option>BbvI </option><option>Bbv12I </option><option>BbvCI </option><option>BccI </option><option>BceAI </option><option>BcgI </option><option>BciVI </option><option>BclI </option><option>BcnI </option><option>BcuI </option><option>BdaI </option><option>BfaI </option><option>BfiI </option><option>BfmI </option><option>BfrI </option><option>BfuI </option><option>BfuAI </option><option>BfuCI </option><option>BglI </option><option>BglII </option><option>BisI </option><option>BlnI </option><option>BlpI </option><option>BlsI </option><option>BmcAI </option><option>Bme18I </option><option>Bme1390I </option><option>Bme1580I </option><option>BmeRI </option><option>BmeT110I </option><option>BmgBI </option><option>BmgT120I </option><option>BmiI </option><option>BmrI </option><option>BmrFI </option><option>BmtI </option><option>BmuI </option><option>BoxI </option><option>BpiI </option><option>BplI </option><option>BpmI </option><option>Bpu10I </option><option>Bpu14I </option><option>Bpu1102I </option><option>BpuAI </option><option>BpuEI </option><option>BpuMI </option><option>BpvUI </option><option>BsaI </option><option>Bsa29I </option><option>BsaAI </option><option>BsaBI </option><option>BsaHI </option><option>BsaJI </option><option>BsaMI </option><option>BsaWI </option><option>BsaXI </option><option>Bsc4I </option><option>Bse1I </option><option>Bse8I </option><option>Bse21I </option><option>Bse118I </option><option>BseAI </option><option>BseBI </option><option>BseCI </option><option>BseDI </option><option>Bse3DI </option><option>BseGI </option><option>BseJI </option><option>BseLI </option><option>BseMI </option><option>BseMII </option><option>BseNI </option><option>BsePI </option><option>BseRI </option><option>BseSI </option><option>BseXI </option><option>BseX3I </option><option>BseYI </option><option>BsgI </option><option>Bsh1236I </option><option>Bsh1285I </option><option>BshFI </option><option>BshNI </option><option>BshTI </option><option>BshVI </option><option>BsiEI </option><option>BsiHKAI </option><option>BsiHKCI </option><option>BsiSI </option><option>BsiWI </option><option>BsiYI </option><option>BslI </option><option>BslFI </option><option>BsmI </option><option>BsmAI </option><option>BsmBI </option><option>BsmFI </option><option>BsnI </option><option>Bso31I </option><option>BsoBI </option><option>Bsp13I </option><option>Bsp19I </option><option>Bsp68I </option><option>Bsp119I </option><option>Bsp120I </option><option>Bsp143I </option><option>Bsp1286I </option><option>Bsp1407I </option><option>Bsp1720I </option><option>BspACI </option><option>BspANI </option><option>BspCNI </option><option>BspDI </option><option>BspEI </option><option>BspFNI </option><option>BspHI </option><option>BspLI </option><option>BspLU11I </option><option>BspMI </option><option>BspMAI </option><option>BspOI </option><option>BspPI </option><option>BspQI </option><option>BspTI </option><option>BspT104I </option><option>BspT107I </option><option>BspTNI </option><option>BspXI </option><option>BsrI </option><option>BsrBI </option><option>BsrDI </option><option>BsrFI </option><option>BsrGI </option><option>BsrSI </option><option>BssAI </option><option>BssECI </option><option>BssHII </option><option>BssKI </option><option>BssMI </option><option>BssNI </option><option>BssNAI </option><option>BssSI </option><option>BssT1I </option><option>Bst6I </option><option>Bst98I </option><option>Bst1107I </option><option>BstACI </option><option>BstAPI </option><option>BstAUI </option><option>BstBI </option><option>Bst2BI </option><option>BstBAI </option><option>Bst4CI </option><option>BstC8I </option><option>BstDEI </option><option>BstDSI </option><option>BstEII </option><option>BstENI </option><option>BstF5I </option><option>BstFNI </option><option>BstH2I </option><option>BstHHI </option><option>BstKTI </option><option>BstMAI </option><option>BstMBI </option><option>BstMCI </option><option>BstMWI </option><option>BstNI </option><option>BstNSI </option><option>BstOI </option><option>BstPI </option><option>BstPAI </option><option>BstSCI </option><option>BstSFI </option><option>BstSLI </option><option>BstSNI </option><option>BstUI </option><option>Bst2UI </option><option>BstV1I </option><option>BstV2I </option><option>BstXI </option><option>BstX2I </option><option>BstYI </option><option>BstZI </option><option>BstZ17I </option><option>Bsu15I </option><option>Bsu36I </option><option>BsuRI </option><option>BsuTUI </option><option>BtgI </option><option>BtgZI </option><option>BtrI </option><option>BtsI </option><option>BtsCI </option><option>BtuMI </option><option>BveI </option><option>Cac8I </option><option>CaiI </option><option>CciNI </option><option>CelII </option><option>CfoI </option><option>CfrI </option><option>Cfr9I </option><option>Cfr10I </option><option>Cfr13I </option><option>Cfr42I </option><option>ClaI </option><option>CpoI </option><option>CseI </option><option>CspI </option><option>Csp6I </option><option>Csp45I </option><option>CspAI </option><option>CspCI </option><option>CviAII </option><option>CviJI </option><option>CviKI-1 </option><option>CviQI </option><option>DdeI </option><option>DinI </option><option>DpnI </option><option>DpnII </option><option>DraI </option><option>DraII </option><option>DraIII </option><option>DrdI </option><option>DriI </option><option>DseDI </option><option>EaeI </option><option>EagI </option><option>Eam1104I </option><option>Eam1105I </option><option>EarI </option><option>EciI </option><option>Ecl136II </option><option>EclHKI </option><option>EclXI </option><option>Eco24I </option><option>Eco31I </option><option>Eco32I </option><option>Eco47I </option><option>Eco47III </option><option>Eco52I </option><option>Eco57I </option><option>Eco72I </option><option>Eco81I </option><option>Eco88I </option><option>Eco91I </option><option>Eco105I </option><option>Eco130I </option><option>Eco147I </option><option>EcoICRI </option><option>Eco57MI </option><option>EcoNI </option><option>EcoO65I </option><option>EcoO109I </option><option>EcoP15I </option><option>EcoRI </option><option>EcoRII </option><option>EcoRV </option><option>EcoT14I </option><option>EcoT22I </option><option>EcoT38I </option><option>EgeI </option><option>EheI </option><option>ErhI </option><option>Esp3I </option><option>FaeI </option><option>FalI </option><option>FaqI </option><option>FatI </option><option>FauI </option><option>FauNDI </option><option>FbaI </option><option>FblI </option><option>Fnu4HI </option><option>FokI </option><option>FriOI </option><option>FseI </option><option>FspI </option><option>FspAI </option><option>FspBI </option><option>Fsp4HI </option><option>GlaI </option><option>GluI </option><option>GsuI </option><option>HaeII </option><option>HaeIII </option><option>HapII </option><option>HgaI </option><option>HhaI </option><option>Hin1I </option><option>Hin1II </option><option>Hin4I </option><option>Hin6I </option><option>HinP1I </option><option>HincII </option><option>HindII </option><option>HindIII </option><option>HinfI </option><option>HpaI </option><option>HpaII </option><option>HphI </option><option>Hpy8I </option><option>Hpy99I </option><option>Hpy188I </option><option>Hpy188III </option><option>HpyAV </option><option>HpyCH4III </option><option>HpyCH4IV </option><option>HpyCH4V </option><option>HpyF3I </option><option>HpyF10VI </option><option>Hsp92I </option><option>Hsp92II </option><option>HspAI </option><option>ItaI </option><option>KasI </option><option>KpnI </option><option>Kpn2I </option><option>KspI </option><option>Ksp22I </option><option>Ksp632I </option><option>KspAI </option><option>Kzo9I </option><option>LguI </option><option>LweI </option><option>MabI </option><option>MaeI </option><option>MaeII </option><option>MaeIII </option><option>MalI </option><option>MamI </option><option>MbiI </option><option>MboI </option><option>MboII </option><option>MfeI </option><option>MflI </option><option>MhlI </option><option>MlsI </option><option>MluI </option><option>MluNI </option><option>MlyI </option><option>Mly113I </option><option>MmeI </option><option>MnlI </option><option>Mph1103I </option><option>MreI </option><option>MroI </option><option>MroNI </option><option>MroXI </option><option>MscI </option><option>MseI </option><option>MslI </option><option>MspI </option><option>Msp20I </option><option>MspA1I </option><option>MspCI </option><option>MspR9I </option><option>MssI </option><option>MunI </option><option>MvaI </option><option>Mva1269I </option><option>MvnI </option><option>MvrI </option><option>MwoI </option><option>NaeI </option><option>NarI </option><option>NciI </option><option>NcoI </option><option>NdeI </option><option>NdeII </option><option>NgoMIV </option><option>NheI </option><option>NlaIII </option><option>NlaIV </option><option>NmeAIII </option><option>NmuCI </option><option>NotI </option><option>NruI </option><option>NsbI </option><option>NsiI </option><option>NspI </option><option>NspV </option><option>OliI </option><option>PacI </option><option>PaeI </option><option>PaeR7I </option><option>PagI </option><option>PalAI </option><option>PasI </option><option>PauI </option><option>PceI </option><option>PciI </option><option>PciSI </option><option>PctI </option><option>PdiI </option><option>PdmI </option><option>PfeI </option><option>Pfl23II </option><option>PflFI </option><option>PflMI </option><option>PfoI </option><option>PhoI </option><option>PinAI </option><option>PleI </option><option>Ple19I </option><option>PmaCI </option><option>PmeI </option><option>PmlI </option><option>PpiI </option><option>PpsI </option><option>Ppu21I </option><option>PpuMI </option><option>PscI </option><option>PshAI </option><option>PshBI </option><option>PsiI </option><option>Psp5II </option><option>Psp6I </option><option>Psp1406I </option><option>Psp124BI </option><option>PspCI </option><option>PspEI </option><option>PspGI </option><option>PspLI </option><option>PspN4I </option><option>PspOMI </option><option>PspPPI </option><option>PspXI </option><option>PsrI </option><option>PstI </option><option>PsuI </option><option>PsyI </option><option>PvuI </option><option>PvuII </option><option>RcaI </option><option>RgaI </option><option>RigI </option><option>RsaI </option><option>RsaNI </option><option>RseI </option><option>RsrII </option><option>Rsr2I </option><option>SacI </option><option>SacII </option><option>SalI </option><option>SanDI </option><option>SapI </option><option>SatI </option><option>Sau96I </option><option>Sau3AI </option><option>SbfI </option><option>ScaI </option><option>SchI </option><option>ScrFI </option><option>SdaI </option><option>SduI </option><option>SetI </option><option>SexAI </option><option>SfaNI </option><option>SfcI </option><option>SfiI </option><option>SfoI </option><option>Sfr274I </option><option>Sfr303I </option><option>SfuI </option><option>SgfI </option><option>SgrAI </option><option>SgrBI </option><option>SgrDI </option><option>SgsI </option><option>SinI </option><option>SlaI </option><option>SmaI </option><option>SmiI </option><option>SmiMI </option><option>SmlI </option><option>SmoI </option><option>SmuI </option><option>SnaBI </option><option>SpeI </option><option>SphI </option><option>SrfI </option><option>Sse9I </option><option>Sse8387I </option><option>SseBI </option><option>SsiI </option><option>SspI </option><option>SstI </option><option>SstII </option><option>StrI </option><option>StuI </option><option>StyI </option><option>StyD4I </option><option>SwaI </option><option>TaaI </option><option>TaiI </option><option>TaqI </option><option>TaqII </option><option>TasI </option><option>TatI </option><option>TauI </option><option>TfiI </option><option>TliI </option><option>Tru1I </option><option>Tru9I </option><option>TseI </option><option>TsoI </option><option>Tsp45I </option><option>Tsp509I </option><option>TspDTI </option><option>TspEI </option><option>TspGWI </option><option>TspMI </option><option>TspRI </option><option>TstI </option><option>Tth111I </option><option>Van91I </option><option>Vha464I </option><option>VneI </option><option>VpaK11BI </option><option>VspI </option><option>XagI </option><option>XapI </option><option>XbaI </option><option>XceI </option><option>XcmI </option><option>XhoI </option><option>XhoII </option><option>XmaI </option><option>XmaCI </option><option>XmaJI </option><option>XmiI </option><option>XmnI </option><option>XspI </option><option>ZraI </option><option>ZrmI </option><option>Zsp2I </option></select> </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="left"> <hr> <input name="defined" value="1" type="checkbox">Only use enzymes with known bases (no N,R,Y...) </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="left"> <input name="IIb" value="1" type="checkbox">Include Type IIb restriction enzymes </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="left"> <input name="IIs" value="1" type="checkbox">Include Type IIs restriction enzymes <hr> When two or more input sequences are searched: </td> </tr> <tr> <td style="font-family: Verdana; font-size: 7pt; text-decoration: none;" valign="top" align="left"> <input name="onlydiff" value="1" type="checkbox">Show only endonucleases showing different restriction patterns for searched sequences. </td></tr></tbody></table><br /><h3 class="post-title entry-title"><a href="http://gadgetsdirectory.blogspot.com/2008/05/reverse-complement-gadget.html">Reverse Complement Gadget</a> </h3> <p><script src="http://gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/rev_complement.xml&synd=open&w=306&h=140&title=Reverse+Complement+-+Bioinformatics+Tools&border=http%3A%2F%2Fgmodules.com%2Fig%2Fimages%2F&output=js"></script><style>.ig_tbl_img .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_img .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_img .ig_smbluelink, .ig_tbl_img .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_img .ig_lgbluelink, .ig_tbl_img .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_tbl_line .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_line .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_line .ig_smbluelink, .ig_tbl_line .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_line .ig_lgbluelink, .ig_tbl_line .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_smbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:9px;text-decoration:underline;}.ig_smbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:9px;text-decoration:underline;}.ig_smbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:9px;text-decoration:underline;}.ig_lgbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:12px;text-decoration:underline;}.ig_lgbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:12px;text-decoration:underline;}.ig_lgbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:12px;text-decoration:underline;}</style><style>.ig_tbl_img table,.ig_tbl_img tr,.ig_tbl_img td,.ig_tbl_img a,.ig_tbl_img span,.ig_tbl_line table,.ig_tbl_line tr,.ig_tbl_line td,.ig_tbl_line a,.ig_tbl_line span,ig_reset{margin:0;padding:0;padding-left:0;padding-right:0;border:0;border-collapse:collapse;float:none;clear:none;width:auto;height:auto;background:transparent none;background-position:0%;font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:1.0;white-space:normal;top:auto;bottom:auto;}</style></p><table class="ig_reset ig_tbl_img" width="306" cellpadding="0" cellspacing="0"><tbody><tr><td style="background-image: url(http://gmodules.com/ig/images/tl.gif); width: 8px; height: 28px;"><br /></td><td style="background-image: url(http://gmodules.com/ig/images/tt.gif); width: auto; height: 28px; text-align: center;"><a target="_top" class="ig_lgbluelink" href="http://www.yourlabdata.com/">Reverse Complement - Bioinformatics Tools</a></td><td style="background-image: url(http://gmodules.com/ig/images/tr.gif); width: 8px; height: 28px;"><br /></td></tr><tr><td style="background-image: url(http://gmodules.com/ig/images/l.gif); width: 8px; height: auto;"><img src="http://www.blogger.com/post-edit.g?blogID=2335515041863838416&postID=8932847724221049869" alt="" width="8" height="1"></td><td><div id="idi_1354436938"><iframe id="iframe_1354436938" name="iframe_1354436938" src="http://www.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/rev_complement.xml&synd=open&w=306&h=140&title=Reverse+Complement+-+Bioinformatics+Tools&border=http%3A%2F%2Fgmodules.com%2Fig%2Fimages%2F&source=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2F2008%2F05%2Freverse-complement-gadget.html#idi_hr=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2Frobots.txt" scrolling="no" width="306" frameborder="0" height="140"></iframe></div><br /></td><td style="background-image: url(http://gmodules.com/ig/images/r.gif); width: 8px; height: auto;"><img src="http://www.blogger.com/post-edit.g?blogID=2335515041863838416&postID=8932847724221049869" alt="" width="8" height="1"></td></tr><tr><td id="bl_1354436938" style="background-image: url(http://gmodules.com/ig/images/bl.gif); width: 8px; height: 28px;"><br /></td><td id="b_1354436938" style="background-image: url(http://gmodules.com/ig/images/b.gif); width: auto; height: 28px;"><div id="imgpromo_1354436938"><table style="width: 100%;"><tbody><tr><td style="text-align: left;"><!--[if IE]><img height="5" width="1" alt="" /><br /><![endif]--><a target="_top" href="http://fusion.google.com/ig/add?synd=open&source=ggyp&moduleurl=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/rev_complement.xml"><img style="border: 0pt none ; height: 17px; width: 68px;" src="http://www.gmodules.com/ig/images/plus_google.gif"></a></td></tr></tbody></table></div></td><td style="background-image: url(http://gmodules.com/ig/images/br.gif); width: 8px; height: 28px;" id="br_1354436938"><br /></td></tr></tbody></table><strong>Description:</strong>"Reverse Complement - Bioinformatics Tools" Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.<br /><strong>Author:</strong> Your Lab Data<br /><br /><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=melting_temp">Melting Temperature (Tm) calculator</a></h4> </td> </tr> <tr> <td colspan="1">This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.<br /></td></tr></tbody></table><br /><br /><div id="remote_35" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://35.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/tm_calculator.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=35&ifpctok=-1619911378081205303&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_35" name="remote_iframe_35" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 220px;" scrolling="no" frameborder="0"><br></iframe></div><br /><table width="100%" border="0" cellpadding="2" cellspacing="2"><tbody><tr><td><h4><a href="http://www.yourlabdata.com/index.php?option=com_bioinformatics&task=micro_sat_finder">Microsatellite Repeats Finder</a></h4> </td> </tr> <tr> <td colspan="1">This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.<br /></td></tr></tbody></table><br /><div id="remote_34" style="border: 0pt none ; margin: 0pt; padding: 0pt; width: 100%;"><iframe src="http://34.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/microsatellite_repeat_finder.xml&nocache=0&lang=ca&country=us&.lang=ca&.country=us&synd=ig&mid=34&ifpctok=-5200252885843958500&parent=http://www.google.com&extern_js=/extern_js/f/CgJlbhICdXMrMBA4ACwrMBI4ACwrMBM4ACw/EzoNAq2fWLM.js" id="remote_iframe_34" name="remote_iframe_34" style="border: 0pt none ; margin: 0pt; padding: 0pt; overflow: hidden; width: 100%; height: 220px;" scrolling="no" frameborder="0"><br></iframe></div><br /><h3 class="post-title entry-title"> <a href="http://gadgetsdirectory.blogspot.com/2008/05/in-silico-pcr-amplification.html">In Silico PCR Amplification</a> </h3> <p><script src="http://gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/pcr.xml&synd=open&w=300&h=410&title=In+Silico+PCR+Amplification&border=%23ffffff%7C1px%2C1px+solid+black%7C1px%2C1px+solid+black%7C0px%2C1px+black&output=js"></script><style>.ig_tbl_img .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_img .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_img .ig_smbluelink, .ig_tbl_img .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_img .ig_lgbluelink, .ig_tbl_img .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_tbl_line .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_line .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_line .ig_smbluelink, .ig_tbl_line .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_line .ig_lgbluelink, .ig_tbl_line .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_smbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:9px;text-decoration:underline;}.ig_smbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:9px;text-decoration:underline;}.ig_smbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:9px;text-decoration:underline;}.ig_lgbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:12px;text-decoration:underline;}.ig_lgbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:12px;text-decoration:underline;}.ig_lgbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:12px;text-decoration:underline;}</style><style>.ig_tbl_img table,.ig_tbl_img tr,.ig_tbl_img td,.ig_tbl_img a,.ig_tbl_img span,.ig_tbl_line table,.ig_tbl_line tr,.ig_tbl_line td,.ig_tbl_line a,.ig_tbl_line span,ig_reset{margin:0;padding:0;padding-left:0;padding-right:0;border:0;border-collapse:collapse;float:none;clear:none;width:auto;height:auto;background:transparent none;background-position:0%;font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:1.0;white-space:normal;top:auto;bottom:auto;}</style></p><table class="ig_reset ig_tbl_line" width="300"><tbody><tr><td colspan="2" style="vertical-align: bottom; text-align: center; width: 100%;"><a target="_top" class="ig_lgbluelink" href="http://www.yourlabdata.com/">In Silico PCR Amplification</a> </td></tr><tr><td style="height: 2px;"><br /></td></tr><tr><td colspan="2"><div style="border: 1px solid black; padding: 1px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div style="border: 1px solid black; padding: 1px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div style="border: 1px none black; padding: 0px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div id="idi_469833685"><iframe id="iframe_469833685" name="iframe_469833685" src="http://www.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/pcr.xml&synd=open&w=300&h=410&title=In+Silico+PCR+Amplification&border=%23ffffff%7C1px%2C1px+solid+black%7C1px%2C1px+solid+black%7C0px%2C1px+black&source=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2Fsearch%2Flabel%2FEducation%3Fmax-results%3D5#idi_hr=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2Frobots.txt" scrolling="no" width="300" frameborder="0" height="410"></iframe></div></div></div></div><br /></td></tr><tr><td style="text-align: left;"><div style="height: 20px;" id="left_469833685"><a target="_top" href="http://fusion.google.com/ig/add?synd=open&source=ggyp&moduleurl=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/pcr.xml"><img style="border: 0pt none ; height: 17px; width: 68px;" src="http://www.gmodules.com/ig/images/plus_google.gif"></a></div></td><td style="text-align: right; vertical-align: middle; height: 18px;"><br /></td></tr></tbody></table><br /><strong>Description:</strong> Simulation of PCR amplification. Allows one mismatch between primer and template.<br /><strong>Author:</strong> Your Lab Data<br /><br /><h3 class="post-title entry-title"> <a href="http://gadgetsdirectory.blogspot.com/2008/05/primer3-basic-edition.html">Primer3 (Basic Edition)</a> </h3> <p><script src="http://gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/primer3_basic.xml&synd=open&w=306&h=380&title=Primer3+%28Basic+Edition%29&border=%23ffffff%7C0px%2C1px+solid+%23004488%7C0px%2C1px+solid+%23005599%7C0px%2C1px+solid+%230077BB%7C0px%2C1px+solid+%230088CC&output=js"></script><style>.ig_tbl_img .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_img .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_img .ig_smbluelink, .ig_tbl_img .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_img .ig_lgbluelink, .ig_tbl_img .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_tbl_line .ig_smbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;}.ig_tbl_line .ig_lgbluetext{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;}.ig_tbl_line .ig_smbluelink, .ig_tbl_line .ig_smbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:9px;text-decoration:underline;}.ig_tbl_line .ig_lgbluelink, .ig_tbl_line .ig_lgbluelink:link{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#0000cc;font-size:12px;text-decoration:underline;}.ig_smbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:9px;text-decoration:underline;}.ig_smbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:9px;text-decoration:underline;}.ig_smbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:9px;text-decoration:underline;}.ig_lgbluelink:hover{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#3366cc;font-size:12px;text-decoration:underline;}.ig_lgbluelink:visited{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#551a8b;font-size:12px;text-decoration:underline;}.ig_lgbluelink:active{font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:normal;white-space:normal;color:#ff0000;font-size:12px;text-decoration:underline;}</style><style>.ig_tbl_img table,.ig_tbl_img tr,.ig_tbl_img td,.ig_tbl_img a,.ig_tbl_img span,.ig_tbl_line table,.ig_tbl_line tr,.ig_tbl_line td,.ig_tbl_line a,.ig_tbl_line span,ig_reset{margin:0;padding:0;padding-left:0;padding-right:0;border:0;border-collapse:collapse;float:none;clear:none;width:auto;height:auto;background:transparent none;background-position:0%;font-family:arial,sans-serif;font-variant:normal;font-style:normal;word-spacing:normal;letter-spacing:normal;vertical-align:middle;text-transform:none;text-indent:0;line-height:1.0;white-space:normal;top:auto;bottom:auto;}</style></p><table class="ig_reset ig_tbl_line" width="306"><tbody><tr><td colspan="1" style="vertical-align: bottom; text-align: center; width: 100%;"><a target="_top" class="ig_lgbluelink" href="http://www.yourlabdata.com/">Primer3 (Basic Edition)</a> </td></tr><tr><td style="height: 2px;"><br /></td></tr><tr><td colspan="2"><div style="border: 1px solid rgb(0, 68, 136); padding: 0px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div style="border: 1px solid rgb(0, 85, 153); padding: 0px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div style="border: 1px solid rgb(0, 119, 187); padding: 0px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div style="border: 1px solid rgb(0, 136, 204); padding: 0px; background: white none repeat scroll 0% 0%; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><div id="idi_11909652"><iframe id="iframe_11909652" name="iframe_11909652" src="http://www.gmodules.com/ig/ifr?url=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/primer3_basic.xml&synd=open&w=306&h=380&title=Primer3+%28Basic+Edition%29&border=%23ffffff%7C0px%2C1px+solid+%23004488%7C0px%2C1px+solid+%23005599%7C0px%2C1px+solid+%230077BB%7C0px%2C1px+solid+%230088CC&source=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2Fsearch%2Flabel%2FEducation%3Fmax-results%3D5#idi_hr=http%3A%2F%2Fgadgetsdirectory.blogspot.com%2Frobots.txt" scrolling="no" width="306" frameborder="0" height="380"></iframe></div></div></div></div></div><br /></td></tr><tr><td style="text-align: left;"><div style="height: 20px;" id="left_11909652"><a target="_top" href="http://fusion.google.com/ig/add?synd=open&source=ggyp&moduleurl=http://hosting.gmodules.com/ig/gadgets/file/115439999889014069916/primer3_basic.xml"><img style="border: 0pt none ; height: 17px; width: 68px;" src="http://www.gmodules.com/ig/images/plus_google.gif"></a></div></td><td style="text-align: right; vertical-align: middle; height: 18px;"><br /></td></tr></tbody></table><br /><strong>Description:</strong>Primer3 is a widely used program for designing PCR primers (PCR = 'Polymerase Chain Reaction'). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.<br /><strong>Author:</strong> Your Lab DataVallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com0tag:blogger.com,1999:blog-2335515041863838416.post-67582625143629803782009-12-03T23:27:00.007+01:002009-12-04T00:12:43.547+01:00Els Bioquímics també la saben tocar ....<div style="text-align: justify;">En <a href="http://en.wikipedia.org/wiki/Jos%C3%A9_Gonz%C3%A1lez">José González</a> és un bioquímic Suec, fill de pares argentins. És famós però per les seves cançons. Acompanyat d'una guitarra clàssica té un estil que alguns anomenen com <span style="font-style:italic;"><a href="http://en.wikipedia.org/wiki/Indie_folk">Indie folk</a></span>. Declara que el seu artista favorit és en <a href="http://en.wikipedia.org/wiki/Silvio_Rodr%C3%ADguez">Sílvio Rodríguez</a>. Va publicar el seu primer disc al 2003 (que es va editar als EEUU i UK al 2005) mentre feia el doctorat en Bioquímica a la Universitat de Gothenburg. L'èxit musical però el va fer deixar els estudis de tercer cicle per dedicar-se al món de la música. El segon disc, titulat <span style="font-style:italic;"><a href="http://www.jose-gonzalez.com/">In our nature</a></span>, el va presentar al Setembre del 2007. Ha declarat que algunes de les lletres d'aquest disc van ser influenciades per la lectura del llibre "El espejismo de Dios" (<span style="font-style:italic;">The God Delusion</span>, 2006) d'en <a href="http://en.wikipedia.org/wiki/Richard_Dawkins">Richard Dawkins</a>. Algunes de les seves cançons o versions han estat utilitzades en diferents episodis d'algunes de les sèries de més èxit com <span style="font-style:italic;">Bones</span> o <span style="font-style:italic;">Brothers & Sisters</span> i en algun <a href="http://www.youtube.com/watch?v=oP5J4W5GQ3w">anunci</a>. La seva versió de la cançó "<span style="font-style:italic;">Massive Attack</span>" va ser utilitzada en un episodi de la quarta temporada de la sèrie <span style="font-style:italic;">House</span> (<span style="font-style:italic;">Massive Attack</span> és la cançó utilitzada com a sintonia principal en aquesta sèrie). <br /><br />Aquí van alguns vídeos seus:<br /><center><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/s4_4abCWw-w&hl=en_US&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/s4_4abCWw-w&hl=en_US&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/9B-h1EEsKDA&hl=en_US&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/9B-h1EEsKDA&hl=en_US&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/oP5J4W5GQ3w&hl=en_US&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/oP5J4W5GQ3w&hl=en_US&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /></center><br /><br />Aquest post inaugura la secció de <a href="http://vallve.blogspot.com/search/label/bioqu%C3%ADmics%20il%C2%B7lustres">Bioquímics il·lustres</a>, encara que el primer bioquímic il·lustre del que hem parlat en aquest blog ha estat en <a href="http://vallve.blogspot.com/2008/12/craig-venter-un-ferm-candidat-al-nobel.html">Craig Venter</a>.</div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com0tag:blogger.com,1999:blog-2335515041863838416.post-64609485821907936422009-11-26T21:49:00.001+01:002009-12-01T21:18:20.786+01:00Tests genetics i Genealogies<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://scienceroll.files.wordpress.com/2008/07/dna-blood85.jpg"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 180px;" src="http://scienceroll.files.wordpress.com/2008/07/dna-blood85.jpg" border="0" alt="" /></a>Des de fa uns anys ençà han sorgit tot una sèrie d'empreses relacionades amb el món dels tests genètics. L'usuari els hi envïa una mostra del seu DNA, l'empresa l'analitza i et ven els resultats. Un tipus d'aquestes empreses et venen "anàlisis d'origen", per exemple:<br /><BLOCKQUOTE><span style="font-style:italic;">Un test .... le permitirá investigar su origen mediante una simple muestra de saliva. Se determinarán su haplogrupo, su pueblo originario y su región de origen. Dependiendo de su perfil genético, una categorización en un solo pueblo antiguo no es posible. Al ser este el caso, recibirá una lista con cada pueblo antiguo posible. El test incluye un acceso sin restricción de tiempo al mayor banco de datos de genealogía ADN en el mundo. Allí puede encontrar familiares que hasta el momento le eran desconocidos.</span></BLOCKQUOTE><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.igenea.com/images/napoleon/napoleon_s.jpg"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 110px;" src="http://www.igenea.com/images/napoleon/napoleon_s.jpg" border="0" alt="" /></a>Un del tests de la companyia <a href="http://www.igenea.com/">iGenea</a> t'ofereixen descobrir si ets descendent de <a href="http://ca.wikipedia.org/wiki/Napole%C3%B3_Bonaparte">Napoleò</a>: <br /><BLOCKQUOTE><span style="font-style:italic;">La gran oportunidad de comparar los perfiles genéticos de los descendientes masculinos directos de Napoleón : compare su perfil con los de otros posibles descendientes.<br /><br />iGENEA busca personas que tengan ascendencia directa por la línea masculina de Napoleón Bonaparte I. La línea directa masculina incluye a su vez los siguientes parentescos con Napoleón.</span></BLOCKQUOTE><br />I és que es tenen dades genètiques d'alguns personatges famosos, veieu el <a href="http://www.isogg.org/famousdna.htm">link</a> següent, entre d'altres:<ul><li>La <a href="http://vallve.blogspot.com/2009/03/el-dna-possa-fi-al-misteri-de-la.html">família Romanov</a><br /><li>Marie Antoinette<br /><li>Jesse James<br /><li>Francesco Petrarca<br /><li><a href="http://vallve.blogspot.com/2009/02/dna-copernic.html">Nicholas Copernicus</a><br /><li><a href="http://vallve.blogspot.com/2008/10/noves-notcies-sobre-lhome-de-gel.html">Otzi</a> o l'home de gel<br /><li>Thomas Jefferson<br /><li>Genghis Khan</ul><br />La majoria d'aquestes dades genètiques corresponen als anomenats <a href="http://en.wikipedia.org/wiki/Haplogroup"><span style="font-style:italic;">DNA Haplotypes</span></a>, és a dir variants en una posició del genoma (coneguts amb el nom de <a href="http://en.wikipedia.org/wiki/Single_nucleotide_polymorphism">SNPs</a>) normalment del genoma mitocondrial o del cromosoma Y, obtinguts a partir de l'anàlisi genètic dels óssos, pèls o altres restes dels personatges. Fins i tot es comença a disposar de més informació genètica d'un sol individu. L'extrem és disposar de la seqüència complerta del genoma. Entre altres, les persones (algunes anònimes, altres amb noms i cognoms) de les quals s'ha seqüenciat el seu genoma són (veieu un llistat més extens en aquest <a href="http://www.eyeondna.com/2009/09/21/people-whove-had-their-genomes-sequenced/">link</a>):<ul><li>James Watson.<br /><li><a href="http://vallve.blogspot.com/2008/12/craig-venter-un-ferm-candidat-al-nobel.html">Craig Venter</a>, el primer genoma diploide en ser seqüenciat. <br /><li>Stephen Quake, un enginyer d'Stanford que ha desenvolupat un nou seqüenciador.<br /><li>George Church, un dels impulsors del <span style="font-style:italic;"><a href="http://vallve.blogspot.com/2009/09/personal-genomes-ii.html">Personal Genome Project</a></span>.<br /><li>Marjolein Kriek, la primera dona a ser seqüenciada.<br /><li>Hermann Hauser, el primer en contractar els <a href="http://investor.illumina.com/phoenix.zhtml?c=121127&p=irol-newsArticle&ID=1298128&highlight=">serveis de l'empresa Illumina</a>. <br /><li><a href="http://vallve.blogspot.com/2008/11/personal-genomes.html">Un xinès</a><br /><li>Seong-Jin Kim.<br /><li>Dos koreans.<br /><li><a href="http://vallve.blogspot.com/2008/11/personal-genomes.html">Un Yoruba de Ibadan, Nigèria</a>.<br /><li>14 individus seqüenciats per <span style="font-style:italic;"><a href="http://www.technologyreview.com/biomedicine/23416/">Complete Genomics</a></span>.<br /><li>6 genomes (i 180 amb un baix <span style="font-style:italic;">coverage</span>) del projecte <span style="font-style:italic;"><a href="http://www.1000genomes.org/page.php">1000 Genomes Project</a></span>.<br /></ul><br /><br />Hi ha força gent interessada en la <a href="http://ca.wikipedia.org/wiki/Genealogia">Genealogia</a> i la cerca dels seus ancestres. Per fer-ho, però, no calen anàlisis de DNA, només molta paciència per cercar tota la informació. Això sí, et pots trobar amb sorpreses i es que tots (en més o menys mesura) estem relacionats. Fixeu-vos per exemple en les <a href="http://en.wikipedia.org/wiki/List_of_United_States_Presidents_by_genealogical_relationship">relacions genealògiques dels presidents dels Estats Units</a>. Com a curiositat us diré que resulta que un servidor és descendent d'un fill bastard del "Señor de Neboeyro", de contrades galleges.</div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-72684585733659949012009-11-24T12:09:00.010+01:002009-11-24T12:58:07.950+01:00Fa 150 anys .....<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.embatllibres.com/content/phpthumb/phpThumb.php?q=90&w=201&h=303&zc=1&src=../products_images/978-84-370-7529_2358[1].jpg"><img style="float:right; margin:0 0 10px 50px;cursor:pointer; cursor:hand;width: 201px; height: 303px;" src="http://www.embatllibres.com/content/phpthumb/phpThumb.php?q=90&w=201&h=303&zc=1&src=../products_images/978-84-370-7529_2358[1].jpg" border="0" alt="" /></a>El 24 de Novembre de 1859 (avui fa 150 anys) es va publicar la primera edició de l'origen de les espècies de <a href="http://vallve.blogspot.com/search/label/Darwin">Charles Darwin</a>. A Internet hi han forces llocs on es fan ressò d'aquest fet. Jo us aconsello la visita als següents:<ul><li><a href="http://http://blocs.mesvilaweb.cat/node/view/id/151376">El buit del temps:El segle i mig de L'origen de les espècies.</a><BR><br /><li><a href="http://http://darwinbeagle.blogspot.com/2009/11/24th-november-1834.html">Charles Darwin's Beagle Diary</a>: Podeu llegir el que va escriu Darwin el 24 de Novembre de 1834 mentre era a bord del Beagle.<BR><br /><li>Com a curiositat podeu veure totes les modificacions que Darwin va fer al llarg de les sis edicions de l'obra a l'adreça <a href="http://benfry.com/traces/">http://benfry.com/traces/</a>.<BR><br /><li>En el <a href="http://books.google.es/books?id=qxu4OXAETlcC&pg=PA18&lpg=PA18&dq=darwin+24th+november&source=bl&ots=1Uk-iiGpGj&sig=D7yDwsFt6rWg72q5rVDAh6KUXyk&hl=ca&ei=z8cLS7ywKMXE4Qbe9YiFBA&sa=X&oi=book_result&ct=result&resnum=7&ved=0CCgQ6AEwBjgK#v=onepage&q=darwin%2024th%20november&f=false">llibre següent</a> podreu llegir algunes dades sobre el nombre de còpies, el benefici que en va treure Darwin o l'editor <a href="http://en.wikipedia.org/wiki/John_Murray_%28publisher%29">John Murray</a>, o va ser realment el 24 de Novembre la data de publicació?<br /></ul></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-57939923068719607182009-10-30T22:25:00.001+01:002009-10-30T22:27:15.634+01:00Made with molecules<div style="text-align: justify;">La unió d'art i ciència no està gaire explotada. Si l'altre dia veiem <a href="http://vallve.blogspot.com/2009/08/science-tattoos.html">tatuatges amb motius científics</a>, avui li toca el torn a les arracades, polseres i collars. Disponibles a <a href="http://www.madewithmolecules.com/">http://www.madewithmolecules.com/:</a><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2DRpB5GjA_MYqYajGC4XRKX23We3jGDdtRQJi-U13QmdZbeu_ba_gldh7gux6KGyI5iiYFxd7U9Ncb8Z_lxl_9mWlvfj_223610Z772w_vOzGRGmccGft9e5_txGIfnoujA5WkWmVRrQ/s1600-h/Art.png"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 420px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2DRpB5GjA_MYqYajGC4XRKX23We3jGDdtRQJi-U13QmdZbeu_ba_gldh7gux6KGyI5iiYFxd7U9Ncb8Z_lxl_9mWlvfj_223610Z772w_vOzGRGmccGft9e5_txGIfnoujA5WkWmVRrQ/s320/Art.png" border="0" alt=""id="BLOGGER_PHOTO_ID_5398505376082530498" /></a></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-62858631594814362242009-10-16T17:50:00.012+02:002009-10-30T10:06:27.651+01:00Com explorar l’estat de la grip a tot el món<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://tree.bio.ed.ac.uk/groups/influenza/wiki/welcome/images/aed38.png"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 128px; height: 176px;" src="http://tree.bio.ed.ac.uk/groups/influenza/wiki/welcome/images/aed38.png" border="0" alt="" /></a>Es pot fer un seguiment "a temps real" de l'estat de la grip a tot el món? Es pot fer a partir de la informació que el cercador google emmagatzema sobre la freqüència d'ús de certes paraules i combinacions quan els usuaris utilitzen aquest cercador?<br />Segons el nou servei que acaba de llançar Google, anomenat "<span style="font-style:italic;"><a href="http://www.google.org/flutrends/intl/ca/">Flu Trends</a></span>":<br /><br /><BLOCKQUOTE>"Ens hem adonat que certs termes de cerca són bons indicadors de la incidència de la grip. "<span style="font-style:italic;">Google Flu Trends</span>" utilitza dades globals de la Cerca de Google per calcular la incidència actual de la grip a tot el món pràcticament en temps real.<br /><br />Cada setmana, milions d'usuaris de tot el món cerquen informació relacionada amb la salut en línia. Com és d'esperar, hi ha més cerques relacionades amb la grip durant la seva temporada, més cerques relacionades amb les al·lèrgies durant la seva temporada i més cerques relacionades amb les cremades solars durant l'estiu. Podeu explorar tots aquests fenòmens amb Estadístiques de cerca de Google. Però, poden proporcionar les tendències de les consultes la base d'un model precís i fiable sobre els fenòmens del món real? Els nostres resultats s'han <a href="http://www.nature.com/nature/journal/v457/n7232/full/nature07634.html">publicat a la revista Nature</a> (en anglès).<br /><br />Hem detectat una estreta relació amb la quantitat de persones que cerquen temes relacionats amb la grip i la quantitat de persones que presenten símptomes de grip. Per descomptat, no tothom que cerca la paraula "grip" té la malaltia, però sorgeix un patró quan totes les consultes de cerca relacionades amb la grip se sumen. Hem comparat els nostres nombres de consultes amb els sistemes tradicionals de monitoratge de la grip i hem detectat que moltes consultes de cerca tendeixen a ser populars en el moment exacte en què es produeix la temporada de la grip. En comptar la freqüència amb què veiem aquestes consultes de cerca, podem calcular quanta grip circula en diversos països i regions de tot el món. Els nostres resultats s'han publicats a la revista Nature (en anglès)."</BLOCKQUOTE><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjymKw3Bo2dzT3h-GD0dFRvAEkvc_lWocB6SAjqh-DUQS51vY26HsTZigB6PmmH_zvSeXb8VO-MKear-6Od5g63HflPT7C_3J7G0MMLz8zWamG4HpmXn6lteJ8Ke_3vQEy3tZsyo0D42e0/s1600-h/Imagen4.png"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 320px; height: 242px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjymKw3Bo2dzT3h-GD0dFRvAEkvc_lWocB6SAjqh-DUQS51vY26HsTZigB6PmmH_zvSeXb8VO-MKear-6Od5g63HflPT7C_3J7G0MMLz8zWamG4HpmXn6lteJ8Ke_3vQEy3tZsyo0D42e0/s320/Imagen4.png" border="0" alt=""id="BLOGGER_PHOTO_ID_5394698516821722066" /></a><center><span style="font-weight:bold;">Criteris de cerca (en anglès) utilitzats per a predir els casos de grip</span>. En blau: Càlcul de Google. En groc: Dades reals de casos de grip a Espanya</center><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://chart.apis.google.com/chart?chxl=0:|2004|2005|2006|2007|2008|2009&chxp=0,27,131,235,339,442,547&chxr=0,0,623&chxs=0,666666,11,-1,t,676767&chxtc=0,7|1,-623&chxt=x&chs=623x200&cht=ls&chco=FF9900,3B66FF&chd=s:BDEGMSWWSOKIFEEDDDCCCBCBBBBBBBABB___________________BBBCCBCCCDCGIj1zhVOKHGFECCCBCBBBB___________________BBBBBBCCCBCCCCDDDDEFHKNQOKGCCBBBB____________________BBBBBCCCCBCDEEJOUZaTLHEDDCBCBBBAA___________________BBBCBCDEFFHLOOUTQNMLJGEDBCCBBBAAB___________________BBBBBCCDDFHMPVSUQMIFFEDDCCBBBBBBBABBBBBBB____________,CDEFINOPRJIGEEECCCCCBBBBBCCBBBBBBBBBBBBBBBBBBBBBBBBBCDDEDDDDDCDFGb460ZNJGGFEHFDCBCCBCBBBBBBBBBBBBBBBBBBCCDDDDCCDDDCCCDDDCDCDDEGIHGFDCCCCCBBBBBBBBBBBBBBBBBBBCDDDDDDDDDDEDGJKNOXWNIEDCDDDDCCBCBBBBBBBBABBBBBBBBBBCDDDDDEDEFGILdheTLIHHHEDCCCCBBBBBBBBBBBBBBBBBBBBBABBBDDDCDDDDDEFJWundQJFDDDDCCBBBBBEDCCCCCBBCCGKIGJKPMGFFG&chls=1.5|2&chm=V,666666,0,0,1,-1|V,666666,0,-1:-1,1,-1|h,666666,0,0,1,-1|h,666666,0,1,1,-1|h,E7E7E7,0,0.2,1,-1|h,E7E7E7,0,0.4,1,-1|h,E7E7E7,0,0.6,1,-1|h,E7E7E7,0,0.8,1,-1|@t123,777777,0,0:0.22,11,1|@t247,777777,0,0:0.42,11,1|@t370,777777,0,0:0.62,11,1|@t493,777777,0,0:0.82,11,1&chma=0,0,0,0"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 623px; height: 200px;" src="http://chart.apis.google.com/chart?chxl=0:|2004|2005|2006|2007|2008|2009&chxp=0,27,131,235,339,442,547&chxr=0,0,623&chxs=0,666666,11,-1,t,676767&chxtc=0,7|1,-623&chxt=x&chs=623x200&cht=ls&chco=FF9900,3B66FF&chd=s:BDEGMSWWSOKIFEEDDDCCCBCBBBBBBBABB___________________BBBCCBCCCDCGIj1zhVOKHGFECCCBCBBBB___________________BBBBBBCCCBCCCCDDDDEFHKNQOKGCCBBBB____________________BBBBBCCCCBCDEEJOUZaTLHEDDCBCBBBAA___________________BBBCBCDEFFHLOOUTQNMLJGEDBCCBBBAAB___________________BBBBBCCDDFHMPVSUQMIFFEDDCCBBBBBBBABBBBBBB____________,CDEFINOPRJIGEEECCCCCBBBBBCCBBBBBBBBBBBBBBBBBBBBBBBBBCDDEDDDDDCDFGb460ZNJGGFEHFDCBCCBCBBBBBBBBBBBBBBBBBBCCDDDDCCDDDCCCDDDCDCDDEGIHGFDCCCCCBBBBBBBBBBBBBBBBBBBCDDDDDDDDDDEDGJKNOXWNIEDCDDDDCCBCBBBBBBBBABBBBBBBBBBCDDDDDEDEFGILdheTLIHHHEDCCCCBBBBBBBBBBBBBBBBBBBBBABBBDDDCDDDDDEFJWundQJFDDDDCCBBBBBEDCCCCCBBCCGKIGJKPMGFFG&chls=1.5|2&chm=V,666666,0,0,1,-1|V,666666,0,-1:-1,1,-1|h,666666,0,0,1,-1|h,666666,0,1,1,-1|h,E7E7E7,0,0.2,1,-1|h,E7E7E7,0,0.4,1,-1|h,E7E7E7,0,0.6,1,-1|h,E7E7E7,0,0.8,1,-1|@t123,777777,0,0:0.22,11,1|@t247,777777,0,0:0.42,11,1|@t370,777777,0,0:0.62,11,1|@t493,777777,0,0:0.82,11,1&chma=0,0,0,0" border="0" alt="" /><center><span style="font-weight:bold;">Incidència de la grip a Espanya</span>. En blau: Càlcul de Google. En groc: Dades reals de casos de grip a Espanya</center></a><br /><br />La idea em sembla bona. L'article on es descriu és del febrer del 2009 i per tant feia referència a l'anomenada grip estacional. Aprofitant la "pandèmia" actual de la grip nova s'han decidit a possar-ho a Internet, creant el "<span style="font-style:italic;">Google Flu Trends</span>". Però no m'imagino un pitjor moment per a fer-ho. Resulta que ara les cerques a Internet sobre la grip segur que han augmentat però degut a l'alarma social i no per un augment del nombre de casos.<br /> <br />Altres recursos sobre la grip:<ul><li><a href="http://www.ecdc.europa.eu/en/activities/surveillance/EISN/Pages/home.aspx">Xarxa Europea de Vigilància de la Grip</a><br /><li><a href="http://www.ncbi.nlm.nih.gov/genomes/FLU/SwineFlu.html">Influenza Virus Resource</a><br /><li><a href="http://tree.bio.ed.ac.uk/groups/influenza/">Human/Swine A/H1N1 Influenza Origins and Evolution</a><br /><li><a href="http://knol.google.com/k/plos/plos-currents-influenza/28qm4w0q65e4w/1#">PLoS Currents: Influenza</a><br /><li><a href="http://knol.google.com/k/andrew-rambaut/the-early-molecular-epidemiology-of-the/1rl276mll9xnz/2?collectionId=28qm4w0q65e4w.1#">The early molecular epidemiology of the swine-origin A/H1N1 human influenza pandemic</a>.<br /></ul><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-82851106636479766092009-10-10T07:00:00.001+02:002009-10-10T07:00:00.462+02:00El joc dels disbarats<div style="text-align: justify;">Qui no ha jugat de petit al joc dels disbarats? En rotllana cada un fa una pregunta i escolta la resposta a qui té a un costat i alhora escolta la pregunta i contesta a qui té a l'altre costat. Després es combinen les preguntes amb les respostes de l'altre costat i els disbarats estan assegurats. Una versió diària d'aquest joc es dóna quan algú li explica a una altre persona una cosa, aquest li explica a l'altre, que li explica a un altres, ..... si comparem la primera versió amb la darrera pot ser que siguin totalment diferents.<br /><br />Una cosa així és el que ha passat amb la notícia del <a href="http://vallve.blogspot.com/2009/10/premi-nobel-de-bioquimica-2009.html">premi Nobel de Química d'aquest any</a>, especialment la notícia que va aparèixer en les versions digitals dels diaris el mateix dia que es va fer públic els premis, el dia 7 d'octubre. (Nota: per entendre plenament aquest post calen uns coneixements mínims d'anglès i unes nocions molt bàsiques de biologia. Els periodistes doncs, no cal que continueu llegint):<br /><br />El <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/2009/press.html">comunicat de premsa</a> de <a href="http://www.kva.se/">La Reial Acadèmia Sueca de les Ciències</a>, en la seva versió anglesa, començava d'aquesta manera:<br /><br /><BLOCKQUOTE>"The Nobel Prize in Chemistry for 2009 awards studies of one of life's core processes: the ribosome's translation of DNA information into life. Ribosomes produce proteins, which in turn control the chemistry in all living organisms. As ribosomes are crucial to life, they are also a major target for new antibiotics.<br /><br />This year's Nobel Prize in Chemistry awards Venkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath for having showed what the ribosome looks like and how it functions at the atomic level. All three have used a method called X-ray crystallography to map the position for each and every one of the hundreds of thousands of atoms that make up the ribosome.<br /><br />Inside every cell in all organisms, there are DNA molecules. They contain the blueprints for how a human being, a plant or a bacterium, looks and functions. But the DNA molecule is passive. If there was nothing else, there would be no life."</BLOCKQUOTE><br /><br />Hi ha una versió en <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/2009/press-sv.html">Suec</a> i una versió en <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/2009/press_hebrew.pdf">hebreu</a> d'aquest comunicat de premsa, però no una versió en castellà. Encara que el text en anglès no es gaire difícil d'entendre, un es pot plantejar utilitzar un traductor automàtic per a traduir-ho al castellà. Si per exemple utilitzem un dels molts traductors que trobem en línea, el <a href="http://translate.google.com/">Google translate</a>, obtindrem la següent versió:<br /><br /><BLOCKQUOTE>"El Premio Nobel de Química en 2009 los estudios de los premios de uno de los procesos básicos de la vida: la traducción del ribosoma de la información del ADN en la vida. Los ribosomas producen proteínas, que a su vez, el control de la química en todos los organismos vivos. Como los ribosomas son cruciales para la vida, también son un blanco importante de nuevos antibióticos.<br /><br />Nobel de este año los premios Nobel de Química Venkatraman Ramakrishnan, Thomas A. Steitz y Ada E. Yonath por haber demostrado lo que el ribosoma, como se ve y cómo funciona a nivel atómico. Los tres han usado un método llamado cristalografía de rayos X para trazar la posición de todos y cada uno de los cientos de miles de átomos que componen el ribosoma.<br /><br />Dentro de cada célula en todos los organismos, hay moléculas de ADN. Contienen los planos de cómo un ser humano, una planta o una bacteria, se ve y funciona. Sin embargo, la molécula de ADN es pasiva. Si no había nada más, no habría vida."</BLOCKQUOTE> <br /><br />Està clar que a un traductor automàtic no li podem demanar meravelles i la traducció es bastant deficient, més si recordes alguna cosa bàsica de biologia. Bé d'acord, qui fa servir un traductor automàtic? Seria millor anar a l'edició electrònica d'algun diari i llegir la notícia, normalment provinent d'alguna agència de notícies com l'agència EFE. La versió, provinent de l'agència EFE, que va sortir en molts diaris digitals o pàgines d'emissores de TV (per exemple el <a href="http://www.diaridetarragona.com/panorama/035203/estadounidenses/israeli/ganan/nobel/quimica">Diari de Tarragona</a>, <a href="http://www.adn.es/internacional/20091007/NWS-0656-Nobel-investigadores-ribosomas-claves-vida.html">adn</a>, <a href="http://www.lavozlibre.com/noticias/ampliar/12745/tres-investigadores-de-los-ribosomas-nobel-de-quimica-2009-">la vozlibre</a>, <a href="http://www.antena3noticias.com/PortalA3N/noticia/ciencia-y-tecnologia/Nobel-Quimica-para-los-investigadores-los-ribosomas-claves-para-vida/8570731">antena3noticias</a>, <a href="http://www.cuatro.com/noticias/noticias/estadounidenses-israeli-premiados-nobel-quimica-2009/20091007ctoultpro_10/">cuatro</a>) el mateix 7 d'octubre era:<br /><br /><BLOCKQUOTE>"La Real Academia Sueca de las Ciencias concedió hoy el Premio Nobel de Química 2009 a tres científicos por descifrar el funcionamiento de los ribosomas, que producen las proteínas necesarias para mantener con vida el ADN.<br /><br />Los científicos estadounidenses Venkatraman Ramakrishnan y Thomas A. Steitz y la israelí Ada E. Yonath lograron mostrar el aspecto y funcionamiento de los ribosomas a nivel molecular mediante un método denominado cristalografía de rayos X.<br /><br />En toda célula de un organismo hay moléculas de ADN que contienen las huellas personales de cada ser vivo, bien sea humano, planta o bacteria. <br /><br />La molécula de ADN, sin embargo, es pasiva y no sería nada si no fuera convertida en materia viva, proceso en el que los ribosomas desempeñan un papel crucial, pues son los responsables de crear las proteínas, las herramientas universales de la vida."</BLOCKQUOTE><br /><br />Fins i tot pitjor que el traductor automàtic .... Em pensava que l'agència EFE era una agència seriosa i que les notícies passaven alguna mena de filtre. No se què es pitjor, que no hagi passat cap filtre, o que ningú s'hagués adonat de que la notícia era bastant deficient. Bé, em podeu dir que he anat a fixar-me en el pitjor, que podria buscar una font de notícies més seriosa com el canal 3/24. Doncs la versió que va aparèixer al teletext i a la <a href="http://www.3cat24.cat/noticia/408688/societat/Nobel-de-Quimica-per-als-pioners-de-la-genetica-per-al-desenvolupament-de-nous-antibiotics">web</a> va ser:<br /><br /><BLOCKQUOTE>"Nobel de Química per als pioners de la <font color="red">genètica</font> per al desenvolupament de nous antibiòtics.<br /><br />Els científics nord-americans Venkatraman Ramakrishnan i Thomas A. Steitz i la israeliana Ada E. Yonath han guanyat el Nobel de Química 2009 pels seus estudis sobre l'estructura i la funció del ribosoma, que produeix les proteïnes necessàries per mantenir amb vida l'ADN. Es tracta dels pioners de la <font color="red">genètica</font> per al desenvolupament de nous antibiòtics. L'Acadèmia Sueca lliurarà el premi el proper 10 de desembre, en l'aniversari de la mort del seu fundador, Alfred Nobel."</BLOCKQUOTE><br /><br />Aquesta versió és en part, una versió traduïda al català de la versió de l'agència EFE, però hi apareixen nous elements: "la genètica" Suposo que està de moda parlar de genètica i la notícia tindrà més impacte si fem servir la paraula en algun lloc, oi?<br /><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-9372846485508314252009-10-07T20:43:00.021+02:002009-10-08T20:26:42.356+02:00Premi Nobel de (Bio)Química 2009<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.cartage.org.lb/en/themes/Sciences/Zoology/AnimalPhysiology/Anatomy/AnimalCellStructure/Ribosomes/ribosome.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand; height: 250px;" src="http://www.cartage.org.lb/en/themes/Sciences/Zoology/AnimalPhysiology/Anatomy/AnimalCellStructure/Ribosomes/ribosome.jpg" border="0" alt="" /></a>La Reial Acadèmia Sueca de les Ciències ha anunciat avui la concessió del <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/2009/index.html">Premi Nobel de Química 2009</a> als científics nordamericans Venkatraman Ramakrishnan (del <span style="font-style:italic;">MRC Laboratory of Molecular Biology</span>, Cambridge, UK), Thomas A. Steitz (del <span style="font-style:italic;">Howard Hughes Medical Institute</span>, Yale University) i la científica israeliana Ada E. Yonath (del <span style="font-style:italic;">Weizmann Institute of Science</span>, Israel) pels "seus estudis sobre l'estructura i funció dels ribosomes". Els <a href="http://ca.wikipedia.org/wiki/Ribosoma">ribosomes</a> (orgànuls formats per una part proteica i RNA ribosòmic, on té lloc la traducció) són peces essencials per a la vida ja que en ells té lloc la síntesi de proteïnes. Els ribosomes, doncs, els trobem en tots els éssers vius. Hi ha però algunes diferències, especialment de mida, entre els ribosomes dels bacteris i els de les cèl·lules <a href="http://ca.wikipedia.org/wiki/Eucariota">eucariotes</a>. Són precisament aquestes diferències les que han permès dissenyar antibiòtics que <a href="http://ca.wikipedia.org/wiki/Antibi%C3%B2tic#Acci.C3.B3_sobre_els_ribosomes">inhibeixen selectivament la funció dels ribosomes dels bacteris</a>. I és que inhibir la funció dels ribosomes representa la mort per a les cèl·lules.<br /><br />Les investigacions sobre l'estructura dels ribosomes es van iniciar fa més de 30 anys i van culminar l'any 2000 amb la determinació, per part dels equips de recerca dels tres guardonats, de l'estructura tridimensional de les dues subunitats que formen els ribosomes. En concret, l'<a href="http://www.ncbi.nlm.nih.gov/sites/entrez?orig_db=PubMed&db=pubmed&cmd=Search&term=%22Science%20%28New%20York%2C%20N.Y.%29%22[Jour]%20AND%20289[volume]%20AND%20905[page]">equip dirigit pel Dr Steitz</a> va determinar l'estructura tridimensional de la subunitat gran del bacteri <span style="font-style:italic;">Haloarcula marismortui</span>, i els equips dels <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?orig_db=PubMed&db=pubmed&cmd=Search&term=%22Cell%22[Jour]%20AND%20102[volume]%20AND%20615[page]">Dr Yonath</a> i <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?orig_db=PubMed&db=pubmed&cmd=Search&term=%22Nature%22[Jour]%20AND%20407[volume]%20AND%20327[page]">Ramakrishnan</a> van determinar, de forma independent, l'estructura de la subunitat petita del bateri <span style="font-style:italic;">Thermus thermophilus</span>. <a href="http://es.wikipedia.org/wiki/Estructura_de_las_prote%C3%ADnas#Determinaci.C3.B3n_de_la_estructura_proteica">Determinar l'estructura tridimensional</a> d'una proteïna significa conèixer la posició tridimensional de tots els àtoms que la formen, i encara que no és tasca senzilla, en l'actualitat es coneixen les <a href="http://www.rcsb.org">estructures</a> de milers de proteïnes.<br /><br />En el cas de l'estructura tridimensional del ribosoma, es valora la gran complexitat que suposa l'obtenció de cristalls (pas previ a la difracció de raigs X i a la <a href="http://vallve.blogspot.com/2009/09/structural-biology-rankings.html">determinació de l'estructura</a>) i la determinació estructural d'un complex format per desenes de subunitats proteiques i subunitats formades per RNA ribosòmic. Aquesta part formada per RNA participa també directament en el mecanisme catalític i per això els ribosomes sovint es posen com a exemple quan es parla dels <a href="http://ca.wikipedia.org/wiki/Ribozim">ribozims</a> (cadena de RNA que té activitat catalítica). <br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://jmol.sourceforge.net/screenshots/Thermus_ribosome_1jgo_and_1giy.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 400px; height: 325px;" src="http://jmol.sourceforge.net/screenshots/Thermus_ribosome_1jgo_and_1giy.jpg" border="0" alt="" /></a><br />Disposar de l'estructura tridimensional dels ribosomes ha permès descobrir els detalls moleculars de la interacció de certs antibiòtics amb els ribosomes i ha proporcionat noves eines per al disseny de nous antibiòtics, alguns d'ells ja en fase d'experimentació, per guanyar així la batalla contra la <a href="http://ca.wikipedia.org/wiki/Resist%C3%A8ncia_als_antibi%C3%B2tics">resistència bacteriana</a> a aquests fàrmacs.<br /><br />A part de la <a href="http://62.81.187.167/sp3/mainframe.php?id=485-01-CLUB5LGumemMmPfppjo4YLQ-423-4824">notícia</a>, durant el procés de cerca d'informació sobre la notícia, m'he fet les següents reflexions:<ul><li>Fixeu-vos la importància que va adquirint la recerca en Biociències (i en Bioquímica) en l'actualitat. Ja van tota una sèrie de <a href="http://nobelprize.org/nobel_prizes/chemistry/">premis Nobel de Química</a> relacionats amb aquests temes (per exemple el de l'any passat i el d'aquest). Haurien de canviar de nom i anomenar-se Premis Nobel de Bioquímica? Veieu també els Premis Nobel de Fisiologia i Medecina.<br /><br /><li>El mal redactat que alguns mitjans de comunicació i pàgines web fan de la notícia. I és que no n'encerten ni una, barregen les coses, exageren desmesuradament el descobriment, o es centren en aspectes secundaris. Aquest punt ja el desenvoluparé amb més detall en un post posterior.<br /><br /><li>L'embolic que es fan alguns amb les nacionalitats: "Los científicos estadounidenses Venkatraman Ramakrishnan y Thomas A. Steitz y la israelí Ada E. Yonath ....", "El indio Venkatraman Ramakrishkan, el estadounidense Thomas A. Steiltz y la israelí Ada Yonath ...." i "El británico Venkatraman Ramakrishnan, el estadounidense Thomas Steitz y la israelí Ada Yonath ...." Tres versions diferents sobre la nacionalitat del Dr Venkatraman Ramakrishnan que va néixer a l'Índia, és ciutadà americà però actualment treballa a Gran Bretanya ....<br /><br /><li>Sempre es diu que els premis Nobel es donen després d'uns 20 anys o més del descobriment/s, investigacions o publicació pels quals són mereixedors dels premis. S'assegura així que els premis es donin a descobriments que hagin tingut una gran repercussió en la societat, recerca, salut, .... Els articles que descriuen les estructures tridimensonals dels ribosomes són de l'any 2000. Només 9 anys, un període curt si el comparem amb altres premis Nobel.<br /><br /><li> L'anterior punt en porta a pensar que potser el premi Nobel per la seqüenciació del genoma humà (2001) caurà aviat<br /><br /><li>Finalment em suggereixen que un post seriós sobre aquest tema hauria d'incloure la informació de quin dia es donen els premis Nobel i la quantia del premi. Doncs els premis es donaran el 10 de Desembre i el premi (en aquest cas a repartir en tres terceres parts) és de 10 milions de corones Sueques.....<br /></ul><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com0tag:blogger.com,1999:blog-2335515041863838416.post-71286989795467157082009-10-05T00:01:00.011+02:002009-10-05T00:01:00.298+02:00Edició il·lustrada de l'origen de les espècies en Català<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.embatllibres.com/content/phpthumb/phpThumb.php?q=90&w=201&h=303&zc=1&src=../products_images/978-84-370-7529_2358[1].jpg"><img style="float:right; margin:0 0 10px 15px;cursor:pointer; cursor:hand;width: 201px; height: 303px;" src="http://www.embatllibres.com/content/phpthumb/phpThumb.php?q=90&w=201&h=303&zc=1&src=../products_images/978-84-370-7529_2358[1].jpg" border="0" alt="" /></a>Per fi tinc entre les mans una <a href="http://www.tv3.cat/videos/1481699">nova edició</a> en català i il·lustrada de l'"<a href="http:// tinyurl.com/ylp7ax">origen de les espècies</a>" de <a href="http://www.aboutdarwin.com/">Charles Darwin</a>. Es tracta d'un llibre de gran format per la seva mida però també per la seva curada edició. No estem davant d'una reedició d'una traducció ja existent, si no que es tracta d'una traducció feta pels investigadors de la Universitat de València <a href="http://blocs.mesvilaweb.cat/pereto">Juli Peretò</a> i <a href="http://www.uv.es/cavanilles/personal/Andres_Moya/">Andrés Moya</a> de la <a href="http://darwin-online.org.uk/content/frameset?itemID=F373&viewtype=side&pageseq=1">primera edició</a>. Tal i com els autors esmenten en el pròleg "<span style="font-style:italic;">Hi ha una opinió general que, de les sis que es publicaren al llarg de quasi vint anys, la primera edició de L'origen és la més vívida i audaç, la que presenta el pensament de Darwin d'una manera més original i directa, sense la càrrega afegida de les respostes a la pluja de crítiques rebudes, moltes de les quals, vistes d'avui, tenen un escàs valor i interès.</span>". Com a curiositat podeu veure totes les modificacions que Darwin va fer al llarg de les sis edicions de l'obra a l'adreça <a href="http://benfry.com/traces/">http://benfry.com/traces/</a>. <br /><br />Aquesta nova versió catalana ha estat però "alleugerida", així s'han escurçat la diversitat d'exemples de l'obra original i s'ha suprimit el capítol on es parla de l'herència, "<span style="font-style:italic;">atès que la informació de la qual disposava l'autor és actualment poc o gens rellevant i té, per tant, un interès purament històric.</span>". M'ha fet gràcia també el fet que com diuen els autors "<span style="font-style:italic;">En alguna part del llibre, que no revelarem, hem deixat anar algun anacronisme: hem emprat el text de Darwin amb exemples contemporanis, només per reforçar la seua condició de clàssic, de plena vigència de les propostes originals.</span>" A veure si trobem aquests anacronismes ...<br /><br />Un altre fet molt destacable de l'obra és que es tracta d'una edició il·lustrada. El llibre conté unes dues-centes il·lustracions fetes per en Carles Puche, moltes d'elles exemplificant les variacions entre espècies molt relacionades d'animals o de plantes o mostrant alguna de les idees que Darwin ens volia transmetre a través del text. I és que de fet, en les sis edicions originals de l'"origen de les espècies", només hi apareix una única figura, la que en aquesta edició catalana apareix en la pàgina 50 i que correspon a un esquema de la divergència de les espècies.<br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://upload.wikimedia.org/wikipedia/commons/f/f4/Darwins_tree_of_life_1859.gif"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 450px; height: 264px;" src="http://upload.wikimedia.org/wikipedia/commons/f/f4/Darwins_tree_of_life_1859.gif" border="0" alt="" /></a><br />M'ha fet gràcia també la figura de la última plana, provinent d'un dels <a href="http://tinyurl.com/cjfzfx">quaderns de notes</a> de Darwin del 1837, de "l'arbre de la vida de Darwin". Una de les primeres representacions de l'anomenat arbre de la vida o "<span style="font-style:italic;"><a href="http://www.sebbm.com/pdf/160/d04160.pdf">tree of life</a></span>".<br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNGCLd2nkFgTYtuYCC_Fzr7sfyt2KBXo-ujb5d1EHS5j79sOmlJPgyUQ_R_QeGHUbm8zuiGloTj9BfkCQb7Nbc4bDvAIc_U1E959ooTYrGDnb1R-7RQSrQm8tb9P1TXP9exBzCbhsUiuo/s1600-h/Darwin_tree.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 271px; height: 320px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNGCLd2nkFgTYtuYCC_Fzr7sfyt2KBXo-ujb5d1EHS5j79sOmlJPgyUQ_R_QeGHUbm8zuiGloTj9BfkCQb7Nbc4bDvAIc_U1E959ooTYrGDnb1R-7RQSrQm8tb9P1TXP9exBzCbhsUiuo/s320/Darwin_tree.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5386619427825606338" /></a><br />En resum, un llibre molt recomanable, ideal per fer un regal. Per cert jo ja el tinc, us haureu de pensar un altre ....<br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com3tag:blogger.com,1999:blog-2335515041863838416.post-7045097205870478332009-09-28T21:55:00.002+02:002009-09-30T09:38:41.771+02:00Manifiesto sobre la Financiación de la Ciencia en España<div style="text-align: justify;">Aquests dies els mitjans de comunicació es fan un tip de parlar sobre els pressupostos de l'any vinent que han de ser aprovats al congrés durant el mes d'octubre. Es destaquen principalment dues coses: les crítiques de quasi tots els partits polítics per la pujada dels impostos i la mala gestió de la crisis econòmica. Ningú no fa esment però d'un altre fet molt rellevant per al futur de la Ciència en aquest país, i és que les primeres dades sobre la inversió del govern en I+D per l'any vinent es parlava de que es reduiria més d'un 30%. Això venien a ser uns 580 mil·lions d'euros, el preu d'uns sis 'ronaldos'. Veieu l'article "<a href="http://www.elpais.com/articulo/sociedad/Hundir/ciencia/precio/ronaldos/elpepusoc/20090917elpepisoc_14/Tes">¿Hundir la ciencia por el precio de seis 'ronaldos'?</a>" Al final sembla que la retallada no serà tan gran, però continua sent una molt mala notícia pel futur científic d'aquest país. Ja s'han sentit algunes reaccions a través d'alguna <a href="http://albertinho-goblin77.blogspot.com/2009/09/espanyatoros-paella-i-sangria.html">carta als diaris</a>, <a href="http://weblogs.madrimasd.org/bioinformatica/archive/2009/09/29/125579.aspx">blogs</a> i també a través de la <a href="http://www.sebbm.es">Sociedad Española de Bioquímica y Biología Molecular</a> que ha elaborat un breu manifest. Aquest blog s'afegeix a aquest manifest, feu-lo córrer. <br /><br /><hr><br />Oviedo, 24 de Septiembre de 2009<br /><br />El presidente y los ex presidentes de la Sociedad Española de Bioquímica y Biología Molecular, con ocasión del 32 Congreso Nacional de Bioquímica y Biología Molecular,<br /><br />MANIFIESTAN:<ul><li>Que deben mantenerse las dotaciones presupuestarias destinadas a la investigación científica básica y, en particular, al Plan Nacional y a los programas de investigación en red.<br /><br /><li>Que el Plan de Economía Sostenible del Gobierno no puede llevarse a efecto con éxito sin contar con una sólida base científica.<br /><br /><li>Que la inversión en I+D es esencial para consolidar, tanto en España, como en Europa, una economía basada en el conocimiento, según lo acordado en la cumbre europea de Lisboa del año 2000.</ul><br /><br />Firman:<br /><br />Miguel Ángel de la Rosa Acosta<br />Federico Mayor Zaragoza<br />Margarita Salas Falgueras<br />Carlos Gancedo Rodríguez<br />Joan J. Guinovart Cirera<br />Jesús Ávila de Grado<br />Vicente Rubio Zamora</div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com4tag:blogger.com,1999:blog-2335515041863838416.post-54739592987001208772009-09-25T08:00:00.020+02:002009-12-11T22:01:51.986+01:00Ingredients per elaborar una bona cervesa<div style="text-align: justify;"><span style="font-weight:bold;">Quins són els ingredients per fer una bona <a href="http://culturillacervecera.blogspot.com/">cervesa</a>?</span> Bàsicament quatre: Malta, aigua, llúpol i llevat. De fet en certs països com Alemanya, per llei la cervesa només pot estar formada per aquests quatre ingredients. Anem per parts:<ul><li><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.aiai.ed.ac.uk/project/i-room/resources/vwow/WhiskyStory/10-green%20malt.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 150px;" src="http://www.aiai.ed.ac.uk/project/i-room/resources/vwow/WhiskyStory/10-green%20malt.jpg" border="0" alt="" /></a><span style="font-weight:bold;"><a href="http://en.wikipedia.org/wiki/Malt">Malta</a></span>: La malta no es res més que l'ordi (<a href="http://en.wikipedia.org/wiki/Barley">barley</a> en anglès o <a href="http://es.wikipedia.org/wiki/Cebada">cebada</a> en castellà) germinat. El primer pas del <a href="http://es.wikipedia.org/wiki/Elaboraci%C3%B3n_de_cerveza">procés d'elaboració de la cervesa</a>, anomenat <a href="http://es.wikipedia.org/wiki/Malta_%28cereal%29">Maltatge</a> o <span style="font-style:italic;">malting</span> té com a objectiu transformar l'ordi, germinant-lo en malta. En aquest procés es sintetitzen els enzims (<a href="http://ca.wikipedia.org/wiki/Amilasa">amilases</a>, <a href="http://en.wikipedia.org/wiki/Cellulase">cel·lulases</a> i <a href="http://en.wikipedia.org/wiki/Proteases">proteases</a> principalment del propi ordi, amb l'objectiu de que la llavor creixi per regenerar una nova planta) per a transformar el <a href="http://es.wikipedia.org/wiki/Almid%C3%B3n">midó</a> en <a href="http://es.wikipedia.org/wiki/Glucosa">glucosa</a> i <a href="http://es.wikipedia.org/wiki/Maltosa">maltosa</a>. En aquest procés cal controlar molt bé la Temperatura i humitat. Obtenir una bona cervesa depèn en bona part de la qualitat de l'ordi i malta obtinguts.<br /><br /><li><span style="font-weight:bold;">Aigua</span>: No calen més observacions sobre aquest ingredient, oi? Un cop l'ordi ha germinat es molt i s'afegeix aigua. L'objectiu és degradar el midó en sucres fermentables (glucosa i maltosa principalment) és a dir fer una <a href="http://culturillacervecera.blogspot.com/2009/09/sacarificacion.html">sacarificació</a>. La producció de proteases i cel·lulases i el fet de moldre la malta ajudaran a que les amilases accedeixin més fàcilment al midó. Les proteases també ens serviran per treure la terbolesa i són importants en l'estabilitat i <a href="http://www.expasy.org/spotlight/back_issues/sptlt048.shtml">formació de l'escuma</a> del producte final. Cal destacar que l'aigua participa directament en el mecanisme de reacció dels enzims de la classe de les hidrolases (amilases, cel·lulase i proteases entre altres).<br /><br /><li><span style="font-weight:bold;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://i.treehugger.com/images/2007/5/24/hop%20blossom.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 150px;" src="http://i.treehugger.com/images/2007/5/24/hop%20blossom.jpg" border="0" alt="" /></a>Llúpol</span> (<a href="http://es.wikipedia.org/wiki/Humulus_lupulus">lúpulo</a> en castellà o hop en anglès): És un producte vegetal que es va introduir l'any 1133 per conservar millor el producte final. Això és pels seus efectes bactericides. Avui en dia no caldria afegir-ho per aquest motiu, però resulta que és l'ingredient que li dóna el característic gust amarg a la cervesa, així doncs el gust d'una cervesa sense llúpol ja no ens semblaria cervesa. S'afegeix en el procés de cocció del most o <span style="font-style:italic;">boiling</span>. El temps i T de la cocció influiran en el producte final. La cervesa negra està més "torrada" que la rosa.<br /><br /><li><span style="font-weight:bold;">Llevat</span>: Microorganisme encarregat de transformar la glucosa i altres sucres fermentables originats en la hidròlisis del midó de l'ordi en etanol i CO<sub>2</sub>. Aquest procés conegut com <a href="http://es.wikipedia.org/wiki/Fermentaci%C3%B3n_alcoh%C3%B3lica">fermentació alcohòlica</a> té lloc en condicions anaeròbiques (absència d'oxigen) i té lloc en els anomenats fermentadors. Bàsicament s'utilitzen dues espècies de llevat: <span style="font-style:italic;"><a href="http://es.wikipedia.org/wiki/Saccharomyces_cerevisiae">Saccharomyces cerevisiae</a></span> (el mateix llevat utilitzat en l'elaboració del vi, elaboració del pa, ....) i <span style="font-style:italic;"><a href="http://es.wikipedia.org/wiki/Saccharomyces_carlsbergensis">Saccharomyces carlsbergensis</a></span>. El llevat no pot utilitzar el midó, doncs li manquen els enzims necessaris per la seva hidròlisi. Així doncs, les primeres etapes de l'elaboració de la cervesa es centren en obtenir a partir del midó, glucosa i altres sucres fermentables. Com a curiositat, el CO<sub>2</sub> obtingut durant la fermentació es recull i s'afegeix més tard, en el procés anomenat carbonatació.</ul><br /><br />Tot i que la cervesa es pot elaborar sense l'adició de cap <a href="http://www.cbsbrew.com/Fiches/Fiches_html/Brewing_enzymes.html">enzim extern</a> això no vol dir que no intervinguin enzims en la seva elaboració. Els enzims es trobem en les matèries primeres (ordi, llevats que afegim per fer la fermentació) i s'hauran de controlar les condicions perquè actuïn correctament. En la producció industrial de cervesa, però, cada cop s'utilitzen més enzims "externs" que afegim entre altres coses per poder utilitzar altres matèries primeres, estalviar costos, millorar el procés d'elaboració i el que és més important, perquè el producte final tingui sempre les mateixes característiques. Els enzims "externs" que es poden afegir són amilases, <a href="http://www.biology-online.org/dictionary/Glucoamylase">amiloglucosidases</a>, cel·lulases, <a href="http://www.enzymeindia.com/Enzymes-BetaGlucanase.php">beta-glucanases</a> i proteases en les fases de la maceració i abans i després de la fermentació per tal de millorar la degradació del midó, reduir la terbolesa, augmentar els rendiments o facilitar els filtratges. <br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0pFst61xJPpgL3YSKo_yUd0vgtCuA73oLc4mh_HZZKZkSOEHItj7ApbbqAcumu3btiL54u2Eb5qwutvRCjntzrqahm5E3hBv01EnqlCSwdYx-8Q788NyPV3M6MuaidoglYc_8bOgoYrQ/s1600-h/uhlig+001.bmp"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 400px; height: 380px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0pFst61xJPpgL3YSKo_yUd0vgtCuA73oLc4mh_HZZKZkSOEHItj7ApbbqAcumu3btiL54u2Eb5qwutvRCjntzrqahm5E3hBv01EnqlCSwdYx-8Q788NyPV3M6MuaidoglYc_8bOgoYrQ/s400/uhlig+001.bmp" border="0" alt=""id="BLOGGER_PHOTO_ID_5385392478300727986" /></a><br />Hi pot haver però altres ingredients per elaborar cervesa? Només cal que ens fixem en les etiquetes d'algunes de les cerveses més populars. Per exemple:<ul><li><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.concessiondecals.com/othrbud1.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 200px;" src="http://www.concessiondecals.com/othrbud1.jpg" border="0" alt="" /></a><span style="font-weight:bold;"><a href="http://www.budweiser.com">Budweiser</a></span>: Si ens fixem en els ingredients que figuren en l'etiqueta d'aquesta cervesa hi podrem llegir: <span style="font-style:italic;">"Brewed by our original all natural process using the Choicest Hops, Rice and Best Barley Malt"</span>, una cosa com Elaborada fent servir un procés original i natural fent servir Llúpols seleccionats, Arròs i la millor Malta d'ordi. Arròs? Sí. Una possibilitat en la elaboració de la cervesa és afegir juntament amb la Malta, altres tipus de cereal o arròs. Així es dóna a la cervesa un toc diferent. Segons la web de Budweiser: "<span style="font-style:italic;">We brew our lager using fresh, verdant rice -milled, polished, graded and immediately brewed -never stored- to give Budweiser its light, crisp and refreshing taste</span>"<br /><br /><li><a href="http://www.fostersbeer.com/">Fosters</a>: Si ens fixem en els ingredients que figuren en l'etiqueta d'aquesta cervesa australiana hi trobarem: <span style="font-style:italic;">"Agua, Cebada Malteada, Jarabe de Glucosa, Lúpulo"</span> <a href="http://es.wikipedia.org/wiki/Jarabe_de_ma%C3%ADz">Xarop de Glucosa</a>? Sí, normalment obtingut també a partir de la hidròlisis enzimàtica del midó de l'ordi. L'objectiu de les primeres etapes de l'elaboració de la cervesa és l'obtenció de sucres fermentables a partir del midó, per què no afegir directament glucosa per a que els llevats la transformin en etanol? M'imagino que així s'estalvien ordi i bona part de les etapes del seu processat. El gust d'aquesta cervesa és molt menys intens que les altres. De totes maneres la cervesa no és només etanol i CO<sub>2</sub>. Fixeu-vos que en cap cas es substitueix tot l'ordi per xarop de glucosa i és que en l'ordi també hi trobem altres substàncies que trobem en el producte final.<br /><br /><li>Una altra possibilitat és afegir ordi o altres cereals sense germinar després del maltatge. Així podem augmentar la producció perquè part de l'ordi no cal que germini o podem obtenir cerveses amb característiques finals diferents. Si es fa això és important afegir els enzims (amilases, proteases, cel·lulases) per fer la maceració correctament. En últim extrem es podria partir directament de l'ordi sense germinar si afegim els enzims necessaris per degradar el midó. Recentment l'empresa <a href="http://www.novozymes.tv/#video/508382/page/1">Novozymes</a> acaba de comercialitzar un enzim o còctel d'enzims per fer precisament això: cervesa a partir d'ordi sense germinar, i ja hi ha una empresa que comercialitzarà aquesta cervesa. Ja veurem quina és la seva qualitat.</ul><br /><br />En relació al procés d'elaboració de la cervesa, fa un temps us vaig parlar de les <a href="http://vallve.blogspot.com/2008/09/la-cincia-de-la-cervesa-light.html">cerveses light</a>, per tant no cal afegir res més sobre aquest tema.<br /><br />Finalment us deixo el vídeo del programa <a href="http://www.tv3.cat/pprogrames/quequicom/qqcSeccio.jsp?seccio=home">Quèquicom</a> va dedicar a la cervesa:<br /><object width="320" height="277" id="SVP1722059IE"><param name="movie" value="http://www.tv3.cat/svp2/svp2.swf"></param><param name="scale" value="noscale"></param><param name="align" value="tl"></param><param name="swliveconnect" value="true"></param><param name="menu" value="true"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><param name="FlashVars" value="VIDEO_ID=1722059&FD=1722059&WIDTH=320&HEIGHT=240&USE_LINK_TOCONTEXT=true"></param><embed width="320" height="277" type="application/x-shockwave-flash" src="http://www.tv3.cat/svp2/svp2.swf" id="SVP1722059" scale="noscale" name="SVP1722059" salign="tl" swliveconnect="true" menu="true" allowfullscreen="true" allowscriptaccess="always" FlashVars="VIDEO_ID=1722059&FD=1722059&WIDTH=320&HEIGHT=240&USE_LINK_TOCONTEXT=true" ></embed></object><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-79625327861585830462009-09-21T19:30:00.039+02:002009-09-21T20:25:03.167+02:00Structural Biology Rankings<div style="text-align: justify;">Els científics tenen la mania de fer <a href="http://vallve.blogspot.com/search/label/ranquings%20cientifics">rànquings</a>, organitzar <a href="http://vallve.blogspot.com/search/label/competicions%20i%20premis%20cient%C3%ADfics">competicions i premis científics</a>. I és que els científics són molt competitius. Un dels darrers rànquings que he trobat és l'anomenat <a href="http://www.molecularstructure.org/">Structural Biology Rankings</a> (rànquing sobre Biologia Estructural). Aquest rànquing pretén destacar les <a href="http://en.wikipedia.org/wiki/Protein_structure">estructures de proteïnes</a> (així com els investigadors que les han obtingut) que han tingut més repercussió científica, mesurada segons el nombre de cops que una estructura ha estat descarregada d'Internet (en concret del repositori <a href="http://www.wwpdb.org/top10.php">Worldwide Protein Data Bank</a>) i el nombre de cites dels articles que les descriuen. Com tot rànquing, els criteris utilitzats per fer-lo són subjectius i si es canviessin, el rànquing seria totalment diferent. <br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.daviddarling.info/images/hemoglobin.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 103px;" src="http://www.daviddarling.info/images/hemoglobin.jpg" border="0" alt="" /></a>Jo potser faria un esment especial a la primera estructura d'una proteïna que es va obtenir: la de l'<a href="http://en.wikipedia.org/wiki/Hemoglobin">hemoglobina</a>, determinada al 1959 per <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/1962/perutz-bio.html">Max Perutz</a>, per la que guanyaria el premi <a href="http://nobelprize.org/nobel_prizes/chemistry/laureates/1962/index.html">Nobel de Química al 1962</a>. I és que obtenir l'estructura d'una proteïna (és a dir, determinar la posició tridimensional exacte de tots els àtoms que la formen) no es senzill. Primer de tot cal purificar-la i després <a href="http://en.wikipedia.org/wiki/X-ray_crystallography#Crystallization">cristal·litzar-la</a>. Un cop s'han obtingut els cristalls (feina no gaire fàcil, ja que no totes les proteïnes cristal·litzen amb facilitat) el mètode més emprat per determinar la seva estructura és utilitzar la informació del resultat de la <a href="http://en.wikipedia.org/wiki/X-ray_crystallography#Overview_of_single-crystal_X-ray_diffraction">difracció</a> de <a href="http://en.wikipedia.org/wiki/X-ray_crystallography">raigs X</a> a través dels cristalls de la proteïna per deduir la posició exacte de tots els àtoms. <br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.new-science-press.com/info/illustration_files/nsp-protein-5-2-5_3.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 556px;" src="http://www.new-science-press.com/info/illustration_files/nsp-protein-5-2-5_3.jpg" border="0" alt="" /></a><br /><center><br />Aquí us deixo el Rànquing de les 10 primeres estructures:<table><tr><th WIDTH=100>Molecule</th><th WIDTH=80>Release date</td><th WIDTH=80>Citations</th><th WIDTH=80>Downloads</th><th WIDTH=80>Final score</th></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/cgi/explore.cgi?pdbId=1bl8">POTASSIUM CHANNEL (KCSA) FROM STREPTOMYCES LIVIDANS</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1bl8_bio_r_250.jpg" width="150"></td><td>1998-07-29</td><td>1118</td><td>39249</td><td>6880</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/cgi/explore.cgi?pdbId=1F88">CRYSTAL STRUCTURE OF BOVINE RHODOPSIN</a></td></tr><br /><tr><td><img src="http://www.rcsb.org/pdb/images/1f88_bio_r_250.jpg" width="150"></td><td>2000-08-04</td><td>642</td><td>39441</td><td>4387</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1aoi">COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1aoi_bio_r_250.jpg" width="150"></td><td>1998-09-30</td><td>1009</td><td>22054</td><td>3516</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1ffk" width="150">CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1ffk_bio_r_250.jpg" width="150"></td><td>2000-08-14</td><td>645</td><td>20895</td><td>2339</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=2rh1">High resolution crystal structure of human B2-adrenergic G protein-coupled receptor</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/2rh1_bio_r_250.jpg" width="150"></td><td>2007-10-30</td><td>111</td><td>52528</td><td>2222</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1su4">Crystal structure of calcium ATPase with two bound calcium ions</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1su4_bio_r_250.jpg" width="150"></td><td>2004-05-04</td><td>449</td><td>17568</td><td>1781</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1gc1">HIV-1 GP120 CORE COMPLEXED WITH CD4 AND A NEUTRALIZING HUMAN ANTIBODY</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1gc1_bio_r_250.jpg" width="150"></td><td>1998-07-08</td><td>619</td><td>17470</td><td>1691</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1ema">GREEN FLUORESCENT PROTEIN FROM AEQUOREA VICTORIA</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1ema_bio_r_250.jpg" width="150"></td><td>1996-11-08</td><td>280</td><td>41328</td><td>1689</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=1bmf">BOVINE MITOCHONDRIAL F1-ATPASE</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/1bmf_bio_r_250.jpg" width="150"></td><td>1996-12-07</td><td>685</td><td>16354</td><td>1640</td></tr><tr><td colspan=5><a href="http://www.rcsb.org/pdb/explore.do?structureId=2a79">Mammalian Shaker Kv1.2 potassium channel- beta subunit complex</a></td></tr><tr><td><img src="http://www.rcsb.org/pdb/images/2a79_bio_r_250.jpg" width="150"></td><td>2005-07-12</td><td>243</td><td>22927</td><td>1425</td></tr></table></center><br /><br />I el rànquing per funcionalitat:<br /><h2>Top Functionality</h2><br /><ol><li>Photosystem II</li><br /><li>Thylakoid membrane</li><br /><li>Photosystem II reaction center</li><br /><li>Photosynthesis</li><br /><li>Positive regulation of retinoic acid receptor signaling pathway</li><br /><li>Estrogen response element binding</li><br /><li>Thylakoid</li><br /><li>Chromatin remodeling complex</li><br /><li>Estrogen receptor activity</li><br /><li>Estrogen receptor signaling pathway</li><br /></ol><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-39697150821900749502009-09-17T17:04:00.017+02:002009-09-17T18:04:53.644+02:00Homenatge a Mary Travers<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://userserve-ak.last.fm/serve/500/35254785/Mary+Travers+mary_travers.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand;width: 200px;" src="http://userserve-ak.last.fm/serve/500/35254785/Mary+Travers+mary_travers.jpg" border="0" alt="" /></a><a href="http://en.wikipedia.org/wiki/Mary_Travers_%28singer%29">Mary Travers</a>, del trio <a href="http://www.peterpaulandmary.com/">Peter, Paul and Mary</a> ens ha deixat a l'edat de 72 anys, després d'una malaltia. Mary va formar juntament <a href="http://en.wikipedia.org/wiki/Peter_Yarrow">Peter Yarrow</a> i <a href="http://en.wikipedia.org/wiki/Paul_Stookey">Noel (Paul) Stookey</a>, cap al 1962 el grup Peter, Paul and Mary. Grup que va perdurar fins els nostres dies, després de quasi 50 anys cantant i fent cantar. Peter, Paul and Mary va ser i és un dels referents més importants del que podem anomenar com Folk americà. Moltes de les seves cançons han estat i continuen sent cantades per generacions d'arreu del mon. També a Catalunya, doncs moltes d'elles van ser traduïdes al català. A més, Peter, Paul and Mary van cantar i popularitzar cançons (500 miles, BLOWIN' IN THE WIND, DON'T THINK TWICE, IT'S ALL RIGHT, IF I HAD A HAMMER, IF I HAD MY WAY) d'altres autors com <a href="http://www.bobdylan.com">Bob Dylan</a> o <a href="http://es.wikipedia.org/wiki/Reverend_Gary_Davis">Rev. Gary Davis</a>. El tercet que formaven Peter, Paul and Mary era d'una simplicitat meravellosa: dues guitarres tocant amb l'estil <a href="http://es.wikipedia.org/wiki/Fingerpicking">fingerpicking</a>, lletres compromeses i tres veus que combinaven a la perfecció. Però és que no calia res més. No se m'acut altra manera de rendir homenatge a aquesta gran cantant que escoltant alguns dels seus grans temes. Jo us recomano <a href="http://en.wikipedia.org/wiki/Puff,_the_Magic_Dragon">Puff the Magic Dragon</a> (Paf, el drag màgic).<br /><br /><center>Puff the Magic Dragon<br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/Wik2uc69WbU&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/Wik2uc69WbU&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/oQ6YjC3CDhM&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/oQ6YjC3CDhM&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/pYii6nxhvUk&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/pYii6nxhvUk&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/3t4g_1VoGw4&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/3t4g_1VoGw4&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object><br /><br /><br /><object width="425" height="344"><param name="movie" value="http://www.youtube.com/v/yiAqclnq3JA&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/yiAqclnq3JA&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"></embed></object></center></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com1tag:blogger.com,1999:blog-2335515041863838416.post-29328695133368138432009-09-06T00:10:00.002+02:002009-09-06T00:10:00.251+02:00Personal Genomes (ii)<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.personalgenomes.org/images/sequence100b.jpg"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 100px; height: 100px;" src="http://www.personalgenomes.org/images/sequence100b.jpg" border="0" alt="" /></a>Fa temps que es diu que en uns anys serà possible la seqüenciació del genoma de tots aquells que s'ho puguin pagar. Per a que això sigui possible es parla del repte d'arribar a que la seqüenciació del genoma d'un individu costi uns 1000$. Les seqüencies dels nostres genomes de ben segur revolucionaran la medicina, des de la predicció de susceptibilitats a patir alguna malaltia, la prevenció i el seu tractament, l'efecte o efectes secundaris d'alguns fàrmacs, .... De moment estem encara lluny d'aquesta fita, però cada cop estem més a prop i ja disposem de la <a href="http://vallve.blogspot.com/2008/11/personal-genomes.html">seqüència del genoma de diversos individus</a>. Per anar fent boca, fa uns anys es va crear l'anomenat "<a href="http://www.personalgenomes.org">Personal Genome Project</a>" per tal de catalitzar els avenços necessaris per a fer-ho possible. Al 2006 es van reclutar 10 voluntaris (no anònims) dels quals es van prendre mostres de sang, saliva i pell per tal de seqüenciar el seus genomes. Les <a href="http://io9.com/5168176/download-your-genomes-on-bittorrent">seqüències dels genomes</a> d'aquests individus, juntament amb els <a href="http://www.personalgenomes.org/public/">historials mèdics i característiques físiques</a> d'aquests individus han de servir com a banc de proves de la informació que es pot extreure, dificultats que poden sorgir, <a href="http://vallve.blogspot.com/2008/11/ciencia-amb-humor-vi-les-implicacions.html">implicacions ètiques i morals</a>, ...<br /><br />Per divulgar més aquesta iniciativa i conèixer alguns dels participants i del procés seguit fins ara, la productora "<a href="http://www.necessaryfilms.com/genome.html">Necessary Films</a>" ha elaborat un documental força interessant. Aquí en podeu veure els tres primers Webisodes (Nota: Els primers minuts de cada episodi corresponen a una petita introducció sobre el projecte):<br /><center><br />GENOME: The Future Is Now WEBISODE 1<br /><object width="560" height="340"><param name="movie" value="http://www.youtube.com/v/mVZI7NBgcWM&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/mVZI7NBgcWM&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="560" height="340"></embed></object><br /><br />WEBISODE 2<br /><object width="560" height="340"><param name="movie" value="http://www.youtube.com/v/2r9DpthvNKM&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/2r9DpthvNKM&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="560" height="340"></embed></object><br /><br /><br />WEBISODE 3<br /><object width="560" height="340"><param name="movie" value="http://www.youtube.com/v/mgXAO8pv-X4&hl=en&fs=1&"></param><param name="allowFullScreen" value="true"></param><param name="allowscriptaccess" value="always"></param><embed src="http://www.youtube.com/v/mgXAO8pv-X4&hl=en&fs=1&" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="560" height="340"></embed></object></center><br /><br />P.D: La companyia <a href="http://www.illumina.com/">Illumina</a> acaba d'anunciar fa pocs dies que ofereix el <a href="http://investor.illumina.com/phoenix.zhtml?c=121127&p=irol-newsArticle&ID=1298128&highlight=">servei de seqüenciació del genoma d'un individu, de moment per 48.000$</a></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com0tag:blogger.com,1999:blog-2335515041863838416.post-51676420879279203512009-08-31T00:01:00.000+02:002009-08-31T00:01:01.950+02:00Science tattoos<div style="text-align: justify;">Com que fer-se tatuatges està de moda, per què no un tatuatge amb un tema científic? En aquest <a href="http://blogs.discovermagazine.com/loom/science-tattoo-emporium/">blog</a> trobareu algunes idees. Jo us deixo els que he triat per alguns de vosaltres.<br /><br /><font size=2><center>Per a un amant dels arbres filogenètics. El que et pot passar però és que es tatuï un "tree of life" i després l'hagi de canviar per un "forest of life":</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_origin.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 226px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_origin.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_five-kingdoms.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 280px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_five-kingdoms.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_darwins-tree.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 280px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_darwins-tree.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_tree-of-life.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 227px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_tree-of-life.jpg" border="0" alt="" /></a><br /><br /><font size=2><center>Pels nomades que viatgen i que ara sembla que l'èxit els porta a estar entre les estrelles:</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_we-come-in-peace.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 280px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_we-come-in-peace.jpg" border="0" alt="" /></a><br /><br /><font size=2><center>Una cinta de Moebius (que mai s'acaba) com les que representava M.C. Escher:</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_mobius.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 280px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_mobius.jpg" border="0" alt="" /></a><br /><br /><font size=2><center>Per a un amb el mateix nom que aquest personatge i que per fi ja no busca més solapaments:</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.zhippo.com/DarwinEnriquezHOSTED/images/gallery/medium/IMG_0153.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand; height: 300px;" src="http://www.zhippo.com/DarwinEnriquezHOSTED/images/gallery/medium/IMG_0153.jpg" border="0" alt="" /></a><br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiBlxpuOlOzMGMGWz7dQ9HVrdIJzOC8rAgO4-j0wpM76STg8l5ZMtj9wFgSQomJBRDNvxxMGQjIh5xCD5RFLkqBaHwpDoUc0_zscmgnt-GH2TYN3kmXS8Va-CCk8NM9kDOl459GASek4VE/s1600-h/solap.gif"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 281px; height: 211px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiBlxpuOlOzMGMGWz7dQ9HVrdIJzOC8rAgO4-j0wpM76STg8l5ZMtj9wFgSQomJBRDNvxxMGQjIh5xCD5RFLkqBaHwpDoUc0_zscmgnt-GH2TYN3kmXS8Va-CCk8NM9kDOl459GASek4VE/s320/solap.gif" border="0" alt=""id="BLOGGER_PHOTO_ID_5374433264726625234" /></a><br /><br /><font size=2><center>Per a qualsevol malalt dels ordinadors</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_circuit-ankle440.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 280px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_circuit-ankle440.jpg" border="0" alt="" /></a><br /><br /><font size=2><center>Una altra manera de portar el teu nom de pila tatuat</font></center><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_ester.jpg"><img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;width: 233px; height: 210px;" src="http://blogs.discovermagazine.com/loom/wp-content/blogs.dir/27/files/science-tattoo-emporium/thumbs/thumbs_ester.jpg" border="0" alt="" /></a><br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com5tag:blogger.com,1999:blog-2335515041863838416.post-71176134062772509302009-08-28T11:24:00.001+02:002009-08-28T11:50:41.103+02:00El gos d'Obama i com fer un comunicat de premsa<div style="text-align: justify;">Potser haureu vist la <a href="http://www.elpais.com/articulo/sociedad/Solo/genes/controlan/variedad/pelaje/perros/elpepusoccie/20090827elpepusoc_13/Tes">notícia</a> de que ahir la revista <a href="http://www.sciencemag.org">Science</a> va publicar en la secció ScienceExpress un <a href="http://www.sciencemag.org/cgi/content/abstract/1177808">article</a> on es descriu que només 3 gens (RSPO2, FGF5 i KRT71) controlen la variabilitat del pelatge en els gossos. En concret el gen RSPO2 és el responsable de que els gossos tinguin o no bigoti i celles grans, el gen FGF5 està relacionat amb la longitud del pèl i el KRT71 determina si el pèl és ondulat o rissat.<br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.unews.utah.edu/images/thumbs/portuguesewaterdog_thumb.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand; height: 147px;" src="http://www.unews.utah.edu/images/thumbs/portuguesewaterdog_thumb.jpg" border="0" alt="" /></a>Remenant una mica per trobar més detalls sobre la notícia, m'ha fet gràcia el <a href="http://www.unews.utah.edu/p/?r=082009-4">comunicat de premsa que ha fet la Universitat de Utah</a> (dos dels 20 coautors de l'article són d'aquesta Universitat) per difondre la notícia. El títol del comunicat de premsa "Why Obama's Dog Has Curly Hair" (Per què el gos d'Obama té el pèl rissat) ja ho diu tot. Resulta que un dels gossos utilitzats per fer l'estudi és de la raça "<span style="font-style:italic;"><a href="http://en.wikipedia.org/wiki/Portuguese_Water_Dog">Gos d'aigua Portuguès</a></span>", la raça del gos d'Obama. I és precisament aquest fet el que utilitzen com a "ganxo" per a la notícia.<br /><br />Us copio aquí baix el comunicat de premsa (en anglès):<br /><center><br /><span style="font-weight:bold;">Why Obama's Dog Has Curly Hair</span><br /><span style="font-style:italic;">Utah-aided NIH Study Finds 3 Dog Coat Genes</span><br /></center><br /><font size="2">Aug. 27, 2009 - University of Utah researchers used data from Portuguese water dogs - the breed of President Barack Obama's dog Bo - to help find a gene that gives some dogs curly hair and others long, wavy hair.<br />It was part of a National Institutes of Health (NIH) study - published online Thursday, Aug. 27 by the journal Science - showing that variations in only three genes account for the seven major types of coat seen in purebred dogs. The findings also point the way toward understanding complex human diseases caused by multiple genes.<br />"We were part of a team that found three genes that control 90 percent of the seven coat types that characterize different breeds of purebred dogs," says K. Gordon Lark, one of 20 co-authors of the study and a distinguished professor emeritus of biology at the University of Utah.<br />"We helped identify the gene that controls curly or wavy coats," adds study co-author Kevin Chase, a University of Utah research specialist in biology.<br />The study's first author is Edouard Cadieu, and its senior author is Elaine Ostrander, both of the National Human Genome Research Institute in Bethesda, Md. Other authors came from that institute, which is part of NIH, and from the University of California's Davis and Los Angeles campuses, Cornell University in Ithaca, N.Y., and Affymetrix Corp., in Santa Clara, Calif.<br />The study showed that combinations of various forms of only three genes - named RSPO2, FGF5 and KRT71 - account for seven major coat types in purebred dogs.<br />By analyzing more than 1,000 dogs from 80 domestic breeds, the researchers found that RSPO2 is the gene associated with whether or not a dog has a moustache and large eyebrows (known together as "furnishings"); FGF5 is linked to whether a dog's fur is long or short; and KRT71 determines if the hair is curly or wavy.<br /><br /><span style="font-weight:bold;">Mutant Genes and the Well-dressed Dog</span><br /><br />All purebred dogs have the three genes, but the presence or absence of mutant, variant forms of those genes - rather than the ancestral forms inherited from wolves - determines coat types:<br /><br /> - Short-haired dogs like basset hounds have none of the variant genes, just the ancestral form of each gene.<br /> - Wire-haired dogs such as Australian terriers have the variant form of only the RSPO2 gene.<br /> - Dogs with wiry and curly hair - Airedale terriers, for example - have variants of both RSPO2 and KRT71 genes.<br /> - Long-haired dogs like golden retrievers have a variant form of the FGF5 gene.<br /> - Long-haired dogs with furnishings, such as the bearded collie, have variant forms of FGF5 and RSPO2.<br /> - Curly haired dogs such as Irish water spaniels have the variant forms of the FGF5 and KRT71 genes.<br /> - Curly haired dogs with furnishings - such as the bichon frise breed and some Portuguese water dogs, including President Obama's dog Bo - have the variant form of all three genes.<br /><br />Portuguese water dogs come in both curly haired and wavy-haired varieties, depending on what form of the KRT71 gene they have. Chase says wavy-haired Portuguese water dogs fit in the new study's long-hair-with-furnishings category.<br />Chase says breeders characterized First Dog Bo as curly with furnishings, while Lark's Portuguese water dog, Mopsa, has wavy hair, even though she appears pretty curly. Chase notes that the KRT71 gene really controls the extent of curl, not curl versus no curl.<br />What about the fur characteristics of mutts? Because mutts are not part of a closed breeding population like each breed of purebred dog, it's difficult to separate the genetic contributors to their traits, Chase says.<br />"We don't know enough about the genetics of mutts," Lark adds.<br /><br /><span style="font-weight:bold;">From Portuguese Water Dogs to Human Disease</span><br /><br />Chase and Lark assisted the NIH research by sharing data on Portuguese water dogs, which they have studied for years.<br />"Our contribution to this paper is data collected on the Portuguese water dog that indicated that keratin genes controlled the amount of curliness," Lark says. "Our data plus other data from the Ostrander group narrowed this down to KRT71."<br />KRT71 carries the code that produces keratin 71, a structural protein in hair.<br />Even though he and Chase studied the genetics of curliness stemming from KRT71, Lark says the other two genes involved in determining dog coat types are more interesting in the sense that they produce proteins that regulate a variety of processes in living organisms, not just the kind of coat a dog has. That makes them relevant to diseases of dogs and humans.<br />"Dogs share many diseases and other traits with humans," Lark says. "That's why they were used for many decades so extensively for pharmaceutical and medical-physiological-biochemical testing. Not surprisingly they share much of their genome [genetic blueprint] with humans also."<br />Lark says a dog bred for a desired trait may end up, years later, more vulnerable to cancer, immune disorders or other diseases of aging, and thus have a shorter life span.<br />"Ultimately the most important part of this paper - mostly the work of Ostrander's group - is that we will be able to get glimpses of how major regulatory genes interact with other genes to change the functioning of an animal in a way that does not kill it, but that may eventually compromise its longevity or its functioning as it ages," Lark says.<br />Earlier studies involving Ostrander and Lark revealed genetic variations that make small dogs small and account for longevity in dogs.<br /><br /><span style="font-weight:bold;">A Pup for a President and a Geneticist</span><br /><br />Lark, once a soybean geneticist, has run a long-term dog genetics research effort known as the Georgie Project, after Georgie, a stray Portuguese water dog he adopted in 1986. Georgie died in 1996, and when Lark sought a replacement, a breeder sent him Mopsa - now 13 years old - and nagged him to study the breed's genetics.<br />Lark and Chase learned that the breed was ideal for genetics research because all Portuguese water dogs descended from a small group of "founders" and could help the search for genes responsible for complex traits - including human diseases caused by multiple interacting genes.<br />Portuguese water dogs gained publicity earlier this year when President Obama fulfilled his promise to get a dog for his daughters by obtaining Bo, a Portuguese water dog, reportedly as a gift from U.S. Sen. Edward Kennedy, D-Mass.<br />"As a supporter of Obama, I feel glad that he has a good dog," Lark says. "He has good taste and a good dog."<br /><br /> The portion of the new study conducted at the University of Utah was funded by NIH's National Institute of General Medical Sciences, the Judith L. Chiara Charitable Fund and the Nestle Purina PetCare Co.<br /><br />University of Utah Public Relations<br />201 Presidents Circle, Room 308<br />Salt Lake City, Utah 84112-9017<br />(801) 581-6773 fax: (801) 585-3350<br />www.unews.utah.edu</font></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-74744695191652262862009-08-26T19:50:00.021+02:002009-08-26T22:29:51.815+02:00Troben l'aminoacid glicina en el cometa Wild2<div style="text-align: justify;"><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://tbn2.google.com/images?q=tbn:YdgKer7LdnGiGM:https://sharepoint.cisat.jmu.edu/isat/klevicca/Web/NMR_2002/glycine/Glycine2.gif"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 97px; height: 88px;" src="http://tbn2.google.com/images?q=tbn:YdgKer7LdnGiGM:https://sharepoint.cisat.jmu.edu/isat/klevicca/Web/NMR_2002/glycine/Glycine2.gif" border="0" alt="" /></a>Avui el diari <a href="http://www.elpais.com/articulo/sociedad/Hallado/cometa/ingrediente/clave/vida/elpepusoc/20090818elpepisoc_6/Tes">el Pais</a> es fa ressò d'una <a href="http://www.eurekalert.org/pub_releases/2009-08/nsfc-nrm081709.php">notícia</a> apareguda fa uns dies sobre la descoberta en mostres agafades del cometa <a href="http://stardust.jpl.nasa.gov/photo/cometwild2.html">Wild2</a>, de glicina. La <a href="http://ca.wikipedia.org/wiki/Glicina">glicina</a>, un dels 20 <a href="http://es.wikipedia.org/wiki/Amino%C3%A1cido">aminoàcids</a> que formen les proteïnes, està formada per un àtom de C unit a un grup àcid carboxílic (-COOH), dos hidrògens i un grup amino (-NH2). Això el fa l'aminoàcid més petit i que no presenti isomeria. La isomeria és una característica important en els aminoàcids, ja que dels dos <a href="http://es.wikipedia.org/wiki/Enanti%C3%B3mero">enantiòmers</a> possibles (anomenats isòmers D i L), en els éssers vius (a excepció de la paret cel·lular d'alguns bacteris) només trobem l'enantiòmer L. <br /><br /><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://www.nasa.gov/images/content/361286main1_sd_comet_226wide.jpg"><img style="float:right; margin:0 0 10px 10px;cursor:pointer; cursor:hand; height: 183px;" src="http://www.nasa.gov/images/content/361286main1_sd_comet_226wide.jpg" border="0" alt="" /></a>De fet, la descoberta de que les mostres obtingudes de la cua del cometa Wild2 contenien glicina es va fer al 2006, però no ha estat fins ara que ha estat confirmada amb anàlisis més detallats. La història comença el dia 2 de Gener del 2004 quan la sonda <a href="http://www.nasa.gov/mission_pages/stardust/news/stardust_amino_acid.html">Stardust</a> va travessar la cua del cometa, agafant algunes mostres que després enviaria a la Terra. Les anàlisis de les mostres van revelar que en el cometa hi havia un dels aminoàcids més senzills, la glicina. El dubte però era poder afirmar si realment no es tractava d'una contaminació. Els anàlisis que s'han fet ara dels isòtops que contenen les mostres sembla concloure definitivament que la glicina provenia del cometa.<br /><br />La descoberta és important per entendre l'<a href="http://es.wikipedia.org/wiki/Origen_de_la_vida">origen de la vida</a> i com a partir de molècules senzilles (existents en la Terra primitiva) es poden haver format molècules més complexes (com els aminoàcids) precursores de les biomolècules. De fet en els clàssics <a href="http://es.wikipedia.org/wiki/Experimento_de_Miller_y_Urey">experiments de Miller</a> ja s'obtenia l'aminoàcid glicina (a més d'altres molècules orgàniques) a partir de metà, amoníac, hidrogen i aigua, amb descàrregues elèctriques de 60.000 V.<br /><br />Una de les teories (anomenada <a href="http://ca.wikipedia.org/wiki/Pansp%C3%A8rmia">panspèrmia</a>) que podria explicar la formació d'aquestes substàncies és precisament que aparegueren en la Terra portats per les col·lisions de cometes. Personalment, però, trobo que aquests tipus d'explicacions no expliquen com es van sintetitzar aquestes substàncies, si no que traslladen la qüestió a milers d'anys llums de distància. Llàstima també que en el cometa només hagin trobat l'aminoàcid glicina. L'anàlisi de la isomeria d'altres aminoàcids que s'haguessin trobat en el cometa, segur que hagués estat també molt interessant.</div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com2tag:blogger.com,1999:blog-2335515041863838416.post-67115151735204731642009-08-25T14:39:00.017+02:002009-08-25T15:24:25.495+02:00El telescopi un invent d'un catala<div style="text-align: justify;"><a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEinQBCKhuQ6XiBUpYw1M_AEsUhsIJoXDf0dAihmUGDaaJJpYABqCRdF59WQaQUU__RWkyJ5ZPVMaeVs_Fv5UiTVhyphenhyphenSh8zFJ0TqXgD99k5uls0e0_5JJbgMWeQbCUy3YxpAlwHmc8Sn23yc/s1600-h/galileo09.gif"><img style="float:left; margin:0 10px 10px 0;cursor:pointer; cursor:hand;width: 302px; height: 121px;" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEinQBCKhuQ6XiBUpYw1M_AEsUhsIJoXDf0dAihmUGDaaJJpYABqCRdF59WQaQUU__RWkyJ5ZPVMaeVs_Fv5UiTVhyphenhyphenSh8zFJ0TqXgD99k5uls0e0_5JJbgMWeQbCUy3YxpAlwHmc8Sn23yc/s400/galileo09.gif" border="0" alt=""id="BLOGGER_PHOTO_ID_5373880776564227362" /></a>Avui tal i com podeu veure en el logo del cercador Google, es celebra el <a href="http://www.elpais.com/articulo/sociedad/primer/telescopio/presento/hace/400/anos/elpepusoc/20090825elpepusoc_2/Tes">400 aniversari</a> de la presentació del Telescopi. Sembla que tal dia com avui de fa 400 anys, en un sopar d'homenatge a Galileu es va presentar l'invent davant el senat de Venècia. Bona elecció la de fer un sopar, doncs després els assistents van poder fer us de l'invent presentat i observar els satèl·lits de Jupiter. Sembla que durant l'any 1609, l'astrònom <a href="http://en.wikipedia.org/wiki/Galileo_Galilei">Galileu Galilei</a> va rebre la notícia de l'existència d'un aparell, el perspicilli o telescopi, que permetia engrandir els objectes llunyans i en va decidir construir un. Les seves observacions amb el telescopi publicades a Venècia al Maig del 1610 en un llibre titulat <span style="font-style:italic;"><a href="http://en.wikipedia.org/wiki/Sidereus_Nuncius">Sidereus Nuncius</a></span>, un llibre en llatí de només 30 pàgines però que revolucionaria per sempre l'observació dels estels. <br /><br />La invenció del telescopi es un aspecte polèmic. Segons la <a href="http://en.wikipedia.org/wiki/Telescope">versió anglesa de la Wikipedia</a> (i en l'article <a href="http://en.wikipedia.org/wiki/History_of_the_telescope">següent</a>), hi ha controvèrsia sobre quin dels tres holandesos, <a href="http://en.wikipedia.org/wiki/Hans_Lippershey">Hans Lippershey</a>, <a href="http://en.wikipedia.org/wiki/Zacharias_Janssen">Zacharias Janssen</a>, i <a href="http://en.wikipedia.org/wiki/Jacob_Metius">Jacob Metius</a>, va ser l'inventor. De fet, Hans Lipperhey va registrar la patent del telescopi el 2 d'octubre de 1608, però Jacob Metius ho va intentar el 14 d'octubre i Zacharias Janssen el 17 d'octubre del mateix any. La <a href="http://es.wikipedia.org/wiki/Telescopio">versió en espanyol de la Wikipedia</a>, però, ens dóna altres dades. En l'article en espanyol es fa ressò d'una nova teoria segons la qual l'inventor va ser un català de Girona, en Joan Roget al 1590. La nova teoria la va publicar l'informàtic Nick Pelling a la revista anglesa <a href="http://www.historytoday.com/MainArticle.aspx?m=32962&amid=30258487">History Today</a>. Seguint les investigacions d'un altre català Josep Maria Simón de Guilleuma (1886-1965) en Nick descriu la <a href="http://www.elmundo.es/elmundo/2008/09/15/ciencia/1221468578.html">hipòtesis</a> de que algun dels telescopis fets per en Joan Roget van arribar a les mans de Zacharias Janssen que viatja a Holanda per a comprar unes lents noves per al Telescopi. Intenta que en Hans Lipperhey i Jacob Metius li construeixin unes lents noves, sense adonar-se'n que tots dos li roben la idea i intenten patentar l'invent. En Lipperhey va ser el més ràpid i encara que la patent li va ser denegada, va ser recompensat pel govern holandès pel seu invent. És doncs el telescopi un altre invent català?<br /></div>Vallvehttp://www.blogger.com/profile/11938023284982183054noreply@blogger.com3