dissabte, 26 de juny del 2010

10è aniversari del genoma humà

Avui és el desè aniversari de la conferència de premsa conjunta que el Sr Bill Clinton, el Sr. Tony Blair (per videoconferència des del Regne Unit), el Dr Craig Venter (com a representant de la companyia Celera Genomics) i el Dr Francis Collins (com a representant del consorci públic) van fer el 26 de Juny del 2000 per anunciar a tot el món que finalment s'havia seqüenciat el genoma humà. Es posava fi així, amb un empat tècnic, a la "guerra" oberta entre un consorci públic que feia anys que havia engegat el projecte de seqüenciació del genoma humà i una companyia privada, Celera Genomics, que al 1998 va anunciar que entrava en la cursa per a seqüenciar el genoma humà.

Després de 10 anys és un bon moment per fer balanç. Com no podia ser d'una altra manera, la notícia de la seqüenciació del genoma humà va tenir molta repercussió mediàtica. Alguns dels titulars de fa 10 anys van ser:






El fet de disposar de la seqüència del genoma humà no ha tingut tanta repercussió, especialment en el camp biomèdic, com es pensava. Possiblement perquè la realitat és més complexa del que pensem i encara no en sabem prou. Tot i això, ja es comença a utilitzar la informació dels genomes dels individus i sembla que dintre d'uns anys, seqüenciar-nos el genoma de cada un serà una possibilitat per a les persones que es vulguin/puguin gastar 1000$. Aquest és el preu que es pensa que s'hauria d'arribar per a que comencés la seqüenciació en massa del genoma humà. I sembla que no estem tant lluny d'arribar-hi. S'estima que avui en dia seqüenciar el genoma humà d'un individu costa al voltant dels 3000$, molt lluny dels 3000 mil·lions de $ que es creu que es va gastar el consorci públic fa 10 anys.

Com a curiositat en aquest desè aniversari us transcric el discurs de la conferència de premsa abans esmentada. També la podeu sentir en aquest enllaç.


THE WHITE HOUSE

Office of the Press Secretary
______________________________________________________________________________

For Immediate Release June 26, 2000

REMARKS BY THE PRESIDENT,
PRIME MINISTER TONY BLAIR OF ENGLAND (VIA SATELLITE),
DR. FRANCIS COLLINS, DIRECTOR OF THE NATIONAL
HUMAN GENOME RESEARCH INSTITUTE, AND
DR. CRAIG VENTER, PRESIDENT AND CHIEF SCIENTIFIC
OFFICER, CELERA GENOMICS CORPORATION,
ON THE COMPLETION OF THE FIRST SURVEY OF
THE ENTIRE HUMAN GENOME PROJECT


The East Room


10:19 A.M. EDT

THE PRESIDENT: Good morning. I want to, first of all, acknowledge Prime Minister Blair, who will join us by satellite in just a moment, from London. I want to welcome here the Ambassadors from the United Kingdom, Japan, Germany, France. And I'd also like to acknowledge the contributions not only that their scientists, but also scientists from China, made to the vast international consortium that is the Human Genome Project.

I thank Secretary Shalala, who could not be here today; and Secretary Richardson, who is here. Dr. Ruth Kirschstein, Dr. Ari Patrinos, scientists of the Department of Health and Human Services and the Department of Energy, who have played an important role in the Human Genome Project.

I want to say a special word of thanks to my Science Advisor, Dr. Neal Lane. And of course, to Dr. Francis Collins, the Director of the International Human Genome Project; and to the Celera President, Craig Venter. I thank Senator Harkin and Senator Sarbanes for being here, and the other distinguished guests.

Nearly two centuries ago, in this room, on this floor, Thomas Jefferson and a trusted aide spread out a magnificent map -- a map Jefferson had long prayed he would get to see in his lifetime. The aide was Meriwether Lewis and the map was the product of his courageous expedition across the American frontier, all the way to the Pacific. It was a map that defined the contours and forever expanded the frontiers of our continent and our imagination.

Today, the world is joining us here in the East Room to behold a map of even greater significance. We are here to celebrate the completion of the first survey of the entire human genome. Without a doubt, this is the most important, most wondrous map ever produced by humankind.

The moment we are here to witness was brought about through brilliant and painstaking work of scientists all over the world, including many men and women here today. It was not even 50 years ago that a young Englishman named Crick and a brash even younger American named Watson, first discovered the elegant structure of our genetic code. "Dr. Watson, the way you announced your discovery in the journal 'Nature,' was one of the great understatements of all time. This structure has novel features, which are of considerable biological interest." (Laughter.) Thank you, sir. (Applause.)

How far we have come since that day. In the intervening years, we have pooled the combined wisdom of biology, chemistry, physics, engineering, mathematics and computer science; tapped the great strengths and insights of the public and private sectors. More than 1,000 researchers across six nations have revealed nearly all 3 billion letters of our miraculous genetic code. I congratulate all of you on this stunning and humbling achievement.

Today's announcement represents more than just an epic-making triumph of science and reason. After all, when Galileo discovered he could use the tools of mathematics and mechanics to understand the motion of celestial bodies, he felt, in the words of one eminent researcher, "that he had learned the language in which God created the universe."

Today, we are learning the language in which God created life. We are gaining ever more awe for the complexity, the beauty, the wonder of God's most divine and sacred gift. With this profound new knowledge, humankind is on the verge of gaining immense, new power to heal. Genome science will have a real impact on all our lives -- and even more, on the lives of our children. It will revolutionize the diagnosis, prevention and treatment of most, if not all, human diseases.

In coming years, doctors increasingly will be able to cure diseases like Alzheimer's, Parkinson's, diabetes and cancer by attacking their genetic roots. Just to offer one example, patients with some forms of leukemia and breast cancer already are being treated in clinical trials with sophisticated new drugs that precisely target the faulty genes and cancer cells, with little or no risk to healthy cells. In fact, it is now conceivable that our children's children will know the term cancer only as a constellation of stars.

But today's historic achievement is only a starting point. There is much hard work yet to be done. That is why I'm so pleased to announce that from this moment forward, the robust and healthy competition that has led us to this day and that always is essential to the progress of science, will be coupled with enhanced public-private cooperation.

Public and private research teams are committed to publishing their genomic data simultaneously later this year, for the benefit of researchers in every corner of the globe. And after publication, both sets of teams will join together for an historic sequence analysis conference. Together, they will examine what scientific insights have been gleaned from both efforts, and how we can most judiciously proceed toward the next majestic horizons.

What are those next horizons? Well, first, we will complete a virtually error-free final draft of the human genome before the 50th anniversary of the discovery of the double helix, less than three years from now. Second, through sustained and vigorous support for public and private research, we must sort through this trove of genomic data to identify every human gene. We must discover the function of these genes and their protein products, and then we must rapidly convert that knowledge into treatments that can lengthen and enrich lives.

I want to emphasize that biotechnology companies are absolutely essential in this endeavor. For it is they who will bring to the market the life-enhancing applications of the information from the human genome. And for that reason, this administration is committed to helping them to make the kind of long-term investments that will change the face of medicine forever.

The third horizon that lies before us is one that science cannot approach alone. It is the horizon that represents the ethical, moral and spiritual dimension of the power we now possess. We must not shrink from exploring that far frontier of science. But as we consider how to use new discovery, we must also not retreat from our oldest and most cherished human values. We must ensure that new genome science and its benefits will be directed toward making life better for all citizens of the world, never just a privileged few.

As we unlock the secrets of the human genome, we must work simultaneously to ensure that new discoveries never pry open the doors of privacy. And we must guarantee that genetic information cannot be used to stigmatize or discriminate against any individual or group.

Increasing knowledge of the human genome must never change the basic belief on which our ethics, our government, our society are founded. All of us are created equal, entitled to equal treatment under the law. After all, I believe one of the great truths to emerge from this triumphant expedition inside the human genome is that in genetic terms, all human beings, regardless of race, are more than 99.9 percent the same.

What that means is that modern science has confirmed what we first learned from ancient fates. The most important fact of life on this Earth is our common humanity. My greatest wish on this day for the ages is that this incandescent truth will always guide our actions as we continue to march forth in this, the greatest age of discovery ever known.

Now, it is my great pleasure to turn to my friend, Prime Minister Tony Blair, who is joined in the State Dining Room at 10 Downing Street by Dr. Fred Sanger and other world-renowned scientists. With the generous support of the Wellcome Trust, British scientists have played an invaluable role in reaching this milestone.

On behalf of the American people, I would like to thank the Prime Minister, the scientists, and the British nation for the brilliant work you have brought to this international effort.

And, Mr. Prime Minister, I would like to salute not only your unwavering support for genome research, but also your visionary commitment to sparking ever-greater innovation across the full spectrum of science and technology.

And, on a personal note, I can't help but think that the year of your son's birth will always be remembered for the remarkable achievements we announce today. I think his life expectancy has just gone up by about 25 years. (Laughter.)

PRIME MINISTER BLAIR: Well, thank you very much, President Clinton; Bill. It's a great pleasure to join you, and I think of my little boy, Leo, growing up and learning and knowing things that his grandfather, after whom he was named, could not even have dreamt of. And when you contemplate that, it's almost not like different generations, but different eras of human existence. And there are enormous possibilities for him and his generation, but also some dangers, and our job is to try and develop the possibilities and thwart the dangers.

Thank you also, Ambassadors and distinguished guests, for being with us here in London on this momentous day. And as we have this link, can I not for the first time, thank President Clinton for his role in a different topic, the Northern Ireland peace process. He's been an absolutely unstinting friend to me and to the process of peace in Northern Ireland. And as we continue progress with another important step forward today, I want, if I can, Bill, to underline our gratitude for your enormous contribution to that process. Thank you. (Applause.)

I would also like to pay tribute to President Clinton's support for the Human Genome Project, and for the huge role the United States has played in it. As befits an undertaking that can benefit the whole of humankind, this project has also brought together the best of the global scientific community. Many of the giants of our generation have been involved. Nobel prize-winners, like Fred Sanger and Max Peruts, who are here with me today, thank you for all that you have done.

Scientists from Japan and Germany, France, China, and around the world have been involved, as well as the U.K. and the U.S. And this undertaking, therefore, has brought together the public, private and non-profit sectors in an unprecedented international partnership. In particular, I would like to single out the Wellcome Trust, without whose vision and foresight, Britain's 30-percent contribution to the overall result would not have been possible. And I would like, too, to mention the imaginative work of Celera and Dr. Craig Venter, who in the best spirit of scientific competition, has helped accelerate today's achievement.

For let us be in no doubt about what we are witnessing today -- a revolution in medical science whose implications far surpass even the discovery of antibiotics, the first great technological triumph of the 21st century. And every so often in the history of human endeavor there comes a breakthrough that takes humankind across a frontier and into a new era. And like President Clinton, I believe that today's announcement is such a breakthrough -- a breakthrough that opens the way for massive advances in the treatment of cancer and hereditary diseases, and that is only the beginning.

Ever since Francis Crick and Jim Watson and other great Anglo-American scientific partnership made their historic discovery in the middle of the last century, we've known that DNA was the code to life on Earth. And yet, I guess for Crick and Watson, the process of identifying the billions of units of DNA and piecing them together to form a working blueprint of the human race must have seemed almost a superhuman task, beyond the reach of their generation. And yet, today, it is all but complete.

Nothing better demonstrates the way technology and science are driving us, fast-forwarding us all into the future. But with the power of this discovery comes, of course, the responsibility to use it wisely. As with the greatest scientific achievements, the ethical and the moral questions raised by this astonishing breakthrough are profound. We, all of us, share a duty to ensure that the common property of the human genome is used freely for the common good of the whole human race; to ensure that the powerful information now at our disposal is used to transform medicine, not abused, to make man his own creator or invade individual privacy.

For most of us, today's developments are almost too awesome fully to comprehend. They underline the extraordinary scale of economic, technological, scientific change that sweeps across the modern world. I'm proud that Britain has played, with others, a pioneering role in that. But I believe it says something very important about the process of change. We cannot resist change, but our job, indeed our duty, is to make sense of change, to help people through it, to seize the massive opportunities for better health and a better quality of life; and then, with equal vigor, to minimize the threats such developments pose.

The scientists have presented us with that opportunity that now we, all of us, accept the responsibility to make these advances work for all our people in all our countries for the common good of all humankind.

So, Bill, I believe that this underlines the fact that we do, indeed, as we've often said together, live in a global community, and the importance now of working across national frontiers to safeguard our shared values and put this remarkable scientific achievement at the service of all humankind. (Applause.)

THE PRESIDENT: Tony, if I could, I would like to pick up on your last remark. I think everybody genuinely is concerned about the issues you raised, the privacy issues, and the whole general set of ethical, social and legal issues.

And it strikes me that our scientists -- the British and the American scientists, our French, German, Chinese counterparts who worked on this -- were working toward a single, clearly-defined goal in all those countries and in the other countries of the world that will have to live with both the benefits and the challenges of these discoveries.

There are different legal systems, different social mores, but I think that it would be a very good thing if the U.S, the U.K., and anybody else that wants to work with us, could have the same sort of joint endeavor we've had with the Human Genome, to deal with the implications of this; to deal with the legal, the social, the ethical implications. We may have differences from country to country, but I think that, if we work together, we'll give a higher sense of urgency to the project, and we'll get a better product.

And so I'm offering you another partnership. It's easy for me to do, because you'll have to do it, and I'll be gone. (Laughter.)

PRIME MINISTER BLAIR: Well, Bill, I entirely agree with that. And I think the fascinating possibilities of this scientific breakthrough is that it gives us a chance to do so much for our people, but it will raise really difficult ethical and moral and legal questions.

And the decision for us really as humanity is whether we are going to engage in the right cooperation across national frontiers so that we shape our destiny in a way that genuinely does benefit all our people, that makes the most of the possibilities, and faces up to the challenges and the dangers that it poses. And in a way, I think that the scientists that have been involved in this great undertaking have shown the spirit of cooperation that should now motivate the governments in taking this forward another step. They have given us this opportunity that we, all of us, are going to have a common responsibility in using it in the right way.

So as we now go to join our separate events on either side of the Atlantic, I think and believe that that spirit of cooperation, along with the scientific achievement, is something that we can all celebrate. And I'm, once again, proud to have taken part in this event with you, Bill. And all the very best to you and all your team for the work that you've done.

THE PRESIDENT: Thank you. (Applause.) Thank you very much, Tony.

Now, in a few moments, we'll hear from Celera President, Dr. Craig Venter, who shares in the glory of this day, and deservedly so because of his truly visionary pursuit of innovative strategies to sequence the human genome as rapidly as possible. And I thank you, Craig, for what you have done to make this day possible.

And now I'd like to invite Dr. Francis Collins to the lectern. I also want to congratulate him. From his development of some of the central methods for finding human disease genes, to his successful application of those methods, to the discovery of the cystic fibrosis gene in 1989, to his current leadership for the International Human Genome Project, he has combined the talents of rigorous science and a profound sensitivity to ethical, legal and social issues. He is a physician scientist of great faith, compassion, energy and integrity. And he has truly helped us, more than anyone else, to understand how the marvels of genome science will actually improve human health.

So Dr. Collins, please come up to the lectern. (Applause.)

DR. COLLINS: Mr. President, distinguished Ambassadors, ladies and gentlemen. It is truly a humble -- humbling and profound experience to be asked to speak here this morning. First of all, I would like to thank, most sincerely, President Clinton for his remarkable leadership in getting us to this point.

His strong and consistent voice for the importance of innovative science and its responsible uses to better the human condition has been an inspiration to all of us. He knows that genomics is one of the truly interdisciplinary fields of science requiring vigorous and creative involvement from physics, chemistry, engineering, computer science and biology.

I have also had the privilege to witness time and again the President's personal conviction that we must apply just as much energy and attention to solving the ethical, legal and social issues as we do to the bench research, and you saw that demonstrated again a few moments ago. His effective leadership in this area has moved us substantially closer to the time when no American need fear that information about their genome will be used against them.

Science is a voyage of exploration into the unknown. We are here today to celebrate a milestone along a truly unprecedented voyage, this one into ourselves. Alexander Pope wrote, "Know then thyself. Presume not God to scan. The proper study of mankind is man." What more powerful form of study of mankind could there be than to read our own instruction book?

I've been privileged over the last seven years to lead an international team of more than a thousand of some of the best and brightest scientists of our current generation, some of them here in this room, who have been truly dedicated to this goal. Today, we celebrate the revelation of the first draft of the human book of life.

Now, this milestone could only have come about with the happy combination of vision, determination, creative innovation and teamwork, and we stand on many shoulders here today. Beginning 15 years ago, leaders in the Department of Energy, the National Academy of Sciences and the National Institutes of Health, began to dream this dream.

At first, many thought it unrealistic and unattainable; yet, inspired by visionaries such as James Watson, who is here with us this morning, creative geniuses, such as Waterston, Sulston, Lander, Branscomb, Gibbs and many others here with us this morning, entered the fray. The vigorous involvement of talented colleagues in other countries, now including China, France, Germany, Japan and the United Kingdom, have made this project particularly gratifying to me. I would also like to recognize, publicly, the dedicated leadership of my friend and colleague, Ari Patrinos, of the Department of Energy, in moving this project forward so effectively here in the U.S.

Surely, the human genome is our shared inheritance, and it is fitting and proper that we are all working on it together. Now, thus far, every milestone set by the International Human Genome Project has been met -- on schedule or in some cases, ahead of schedule.

Today, we deliver, ahead of schedule again, the most visible and spectacular milestone of all. Most of the sequencing of the human genome by this international consortium has been done in just the last 15 months. During that time, this consortium has developed the capacity to sequence 1,000 letters of the DNA code per second, seven days a week, 24 hours a day. We have developed a map of overlapping fragments that includes 97 percent of the human genome, and we have sequenced 85 percent of this.

The sequence data is of higher quality than expected with half of it in finished or near-finished form. And all of this information has been placed in public databases every 24 hours, where any scientist with an Internet connection can use it to help unravel the mysteries of human biology. Already, more than a dozen genes, responsible for diseases from deafness to kidney disease to cancer, have been identified using this resource just in the last year.

So there is much to celebrate. But I have to tell you that this morning is also a bitter-sweet experience for me, personally. Less than 24 hours ago, I attended the funeral of my beloved sister-in-law, a wonderful marionette artist who brought magic and joy to thousands of children with her art. She died much too soon of breast cancer. The hope and promise of understanding all of the genes in the genome and applying this knowledge to the development of powerful new tools came just too late for her.

I think I speak for all of us in this room, and for the millions of others who have come to believe in the remarkable promise of biomedical research, that we must redouble our efforts to speed the application of these profound and fundamental observations about the human genome to the cure of disease. That most desirable of all outcomes will only come about with a continued powerful and dedicated partnership between basic science investigators and academia, and their colleagues in the biotechnology and pharmaceutical industries.

As the President has said, we still have much to do. Many tasks lie ahead if we are to learn how to speak the language of the genome fluently. Today is most certainly not the end of genomics, but perhaps it's the end of the beginning. Together we must develop the advances in medicine that are the real reason for doing this work. And with just as much vigor, we must provide the protections against potential misuses of genetic information. If there is anyone within the sound of my voice who has not seen that as a priority, I hope today's announcement is the necessary wake-up call.

It's a happy day for the world. It is humbling for me and awe-inspiring to realize that we have caught the first glimpse of our own instruction book, previously known only to God. What a profound responsibility it is to do this work. Historians will consider this a turning point. Researchers in a few years will have trouble imagining how we studied human biology without the genome sequence in front of us.

I particularly welcome the opportunity to celebrate this moment jointly with our scientific colleagues at Celera Genomics, and I wish to express my personal gratitude to Dr. Craig Venter for his openness in the cooperative planning process that led to this joint announcement. I congratulate him and his team on the work done at Celera, which uses an elegant and innovative strategy that is highly complementary to the approach taken by the public project. Much will be learned from a comparison of the two.

I'm happy that today, the only race we are talking about is the human race. (Applause.)

It is now my distinct pleasure to introduce to you Dr. J. Craig Venter, the President of Celera Genomics. Inspired by a life-changing experience as a medical corpsman in Vietnam, Craig charged into the field of human biology with remarkable energy and determination. Never satisfied with the status quo, always seeking new technology, inventing new approaches when the old ones wouldn't do, he has made profound contributions to the field of genomics.

His development of the expressed sequence tag, or EST, approach for sampling the expressed part of the genome, reduced to practice the notion of considering the human genome as a bounded, but ascertainable set of information. Just a few years later, he electrified the scientific community by publishing, with his colleague, Hamilton Smith, the complete sequence of a free-living organism, the bacterium hemophilus influenzae. And just three months ago, using the innovative whole genome shotgun approach he developed, and working with Gerry Rubin of the University of California at Berkeley, he and his colleagues published a sequence of the fruit fly, drosophila, another remarkable milestone in biology.

Articulate, provocative, and never complacent, he has ushered in a new way of thinking about biology. Now under his leadership, Celera Genomics has accomplished a remarkable goal, their own first assembly of the human genome sequence.

It is an honor and a pleasure the invite him to tell you about this landmark achievement. (Applause.)

DR. VENTER: I'm shorter than the previous two speakers. (Laughter.)

Mr. President, Mr. Prime Minister, members of the Cabinet, honorable members of Congress, ambassadors and distinguished guests. Today, June 26, in the year 2000, marks an historic point in the 100,000-year record of humanity. We're announcing today, for the first time our species can read the chemical letters of its genetic code.

At 12:30 p.m. today, at a joint press conference with the public genome effort, Celera Genomics will describe the first assembly of the human genetic code from the whole genome shotgun method. Starting only nine months ago, on September 8, 1999, 18 miles from the White House, a small team of scientists headed by myself, Hamilton Smith, Mark Adams, Gene Myers, and Granger Sutton, began sequencing the DNA of the human genome using a novel method pioneered by essentially the same team five years earlier at the Institute for Genomic Research.

The method used by Celera has determined the genetic code of five individuals. We have sequenced the genome of three females and two males, who have identified themselves has Hispanic, Asian, Caucasian, or African-American. We did this sampling not in an exclusionary way, but out of respect for the diversity that is America, and to help illustrate that the concept of race has no genetic or scientific basis.

In the five Celera genomes, there is no way to tell one ethnicity from another. Society and medicine treats us all as members of populations, where as individuals we are all unique, and population statistics do not apply.

I would like to acknowledge and congratulate Francis Collins and our colleagues in the public genome effort in the U.S., Europe and Asia, for their tremendous effort in generating a working draft of the human genome. I'd also like to personally thank Francis for his direct actions in working with me to foster cooperation in the genome community, and to shift our collective focus to this historic moment and its future impact on humanity. I would also like to thank the President for his commitment to public-private cooperation, and for making this day even more an historic event.

Obviously, our achievements would not have been possible without the efforts of the thousands of scientists around the world who have gone before us in the quest to better understand life at its most basic level. The beauty of science is that all-important discoveries are made by building on the discoveries of others. I continue to be inspired by the work of the pioneering men and women in the broad array of disciplines that had been brought together to enable this great accomplishment.

I would like to particularly acknowledge Charles DeLisi from the Department of Energy, and Jim Watson from Cold Spring Harbor, both here, for their vision in helping to initiate the Genome Project. The completion of the human genetic blueprint would not have possible without the continued investment of the U.S. Government and basic research. I applaud the President's efforts and the work of Congress during the last several years in producing the largest funding increases to fuel the engines of basic science.

At the same time, we could not overlook the investment of the private sector in research in America. There would be no announcement today if it were not for the more than $1 billion that P.E. Biosystems invested in Celera, and into the development of the automated DNA sequencer that both Celera and the public effort used to sequence the genome. In turn, some of the investment was driven by the public investment in science.

Thirty-three years ago, as a young man serving in the medical corps in Vietnam, I learned firsthand how tenuous our hold on life can be. That experience inspired my interest in learning how the trillions of cells in our bodies interact to create and sustain life. When I witnessed firsthand that some men live through devastating trauma to their bodies, while others died after giving up from seemingly small wounds, I realized that the human spirit was at least as important as our physiology.

We're clearly much, much more than the sum total of our genes, just as our society is greater than the sum total of each of us. Our physiology is based on complex and seemingly infinite interactions amongst all our genes and the environment, just as our civilization is based on the interactions amongst all of us.

One of the wonderful discoveries that my colleagues and I have made while decoding the DNA of over two dozen species, from viruses to bacteria to plants to insects, and now human beings, is that we're all connected to the commonality of the genetic code in evolution. When life is reduced to its very essence, we find that we have many genes in common with every species on Earth, and that we're not so different from one another.

You may be surprised to learn that your sequencers are greater than 90 percent identical to proteins in other animals. It's my belief that the basic knowledge that we're providing the world will have a profound impact on the human condition and the treatments for disease, and our view on our place in the biological continuum.

The genome sequence represents a new starting point for science and medicine, with potential impact on every disease. Taking the example, cancer, each day approximately 2,000 die in America from cancer. As a consequence of the genome efforts that you've heard described by Dr. Collins and myself this morning, and the research that will be catalyzed by this information, there's at least the potential to reduce the number of cancer deaths to zero during our lifetimes. The development of new therapeutics will require continued public investment in basic science, and the translations of discoveries into new medicine by the biotechs and pharmaceutical industry.

However, I am concerned, as many of you are, that there are some who will want to use this new knowledge as a basis of discrimination. A CNN-Time poll this morning reported that 46 percent of Americans polled believe that the impact of the Human Genome Project will be negative. We must work together toward higher science literacy and the wise use of our common heritage.

I know from personal discussions with the President over the past several years, and his comments here this morning, that genetic discrimination has been one of his major concerns about the impact of the genomic revolution. While those who will base social decisions on genetic reductionism will be ultimately defeated by science, new laws to protect us from genetic discrimination are critical in order to maximize the medical benefits from genome discoveries.

Some have said to me that sequencing the human genome will diminish humanity by taking the mystery out of life. Poets have argued that genome sequencing is an example of sterilizing reductionism that will rob them of their inspiration. Nothing could be further from the truth. The complexities and wonder of how the inanimate chemicals that are our genetic code give rise to the imponderables of the human spirit should keep poets and philosophers inspired for the millenniums.

Thank you. (Applause.)

THE PRESIDENT: Well, thank you both for those remarkable statements. I suppose, in closing, the most important thing I could do is to associate myself with Dr. Venter's last statement. When we get this all worked out and we're all living to be 150 -- (laughter) -- young people will still fall in love, old people will still fight about things that should have been resolved 50 years ago -- (laughter) -- we will all, on occasion, do stupid things, and we will all see the unbelievable capacity of humanity to be noble. This is a great day.

Thank you very much. (Applause.)

END 10:50 A.M. EDT

divendres, 9 d’abril del 2010

El Frau científic també arriba al PDB

El frau científic és una d'aquelles coses que fa molt de mal a la ciència i a la comunitat científica i que a vegades és difícil de detectar. Com a frau científic podem entendre diferents coses, com la invenció dels resultats, la falsificació o manipulació de les dades o el plagi. En l'article "Historia reciente del fraude en la investigación biomédica" d'en Xavier Bosch, publicat al número 156 de la revista de la Sociedad Española de Bioquímica y Biología Molecular trobareu una descripció d'alguns dels casos més recents de frau en la investigació biomèdica en general. En aquest blog trobareu el que consideren com els 10 casos de frau més importants. Quins poden ser els motius per què alguns científics cometen fraus? Guanyar prestigi o reconeixement o el fet d'inventar-se resultats que beneficien a alguna empresa (inventar-se o exagerar els efectes beneficiosos d'un fàrmac, per exemple) podrien ser algunes de les causes. Per aquest motiu, molts dels articles científics tenen una secció anomenada "Conflic of interests" o "Competing interests" on els autors han d'esmentar per exemple si han rebut finançament d'una empresa per fer l'estudi que presenten.

Quan es demostra un cas de frau científic o hi ha dubtes sobre la veracitat d'uns resultats, la revista en la que es va publicar pot demanar als autors que es retractin de l'article o articles fraudulents o poden fer-ho ells mateixos. Aquests articles apareixen en les bases de dades sota la categoria de "Retracted Publication". Veieu alguns exemples:
  • En aquest cas els mateixos autors es retracten d'alguns dels seus resultats anteriors en dos revistes, per falta de reprodubilitat dels seus resultats (No tindria perquè tractar-se d'un frau, podria ser també un cas d'error).

  • En aquest altre cas és l'editorial de la revista que manifesta que un dels autors va manipular les imatges de l'article.

En el cas de les bases de dades que contenen informació biològica, el procés de retractació fins ara no ha estat gaire corrent, potser perquè no s'havia previst que podia donar-se algun cas. Els casos han començat a sortir, però la reacció d'algunes de les bases de dades no ha estat prou ràpida. Aquest és el cas de 11 estructures de proteïnes de la base de dades PDB. Tot i que a l'agost del 2009 en un comunicat de premsa la University of Alabama at Birmingham va manifestar els dubtes sobre els resultats d'una de les seves treballadores, que diferents mitjans van difondre la notícia i que la revista PNAS en una editorial posa en dubte dos dels seus articles, a dia d'avui (9 d'abril del 2010), 10 d'aquestes estructures encara estan a la base de dades del PDB, sense cap nota de que podrien ser estructures inventades. Sembla ser que la política per retirar una estructura d'aquesta base de dades és que es substitueixi per una estructura millor, o que es retiri per què l'article on es descriu hagi estat retractat per la revista a on es va publicar. En el cas que ens ocupa, només 1 dels articles ha estat retractat i només 1 de les estructures ha estat retirada. La retractació d'un article pot ser un procés llarg i crec que les bases de dades no poden esperar tant, si cal s'han de canviar les normes, no creieu?

dimecres, 7 d’abril del 2010

Nature Supplement on visualizing biological data

Diuen que una imatge val més que mil paraules. Aquest mes la revista Nature methods publica un suplement on-line sobre visualització de dades biològiques. Molt recomanable. Aquí teniu els links:

Foreword

Supplement on visualizing biological data pS1

Daniel Evanko
doi:10.1038/nmeth0310-S1



Commentary

Visualizing biological data—now and in the future ppS2 - S4

Seán I O'Donoghue, Anne-Claude Gavin, Nils Gehlenborg, David S Goodsell, Jean-Karim Hériché, Cydney B Nielsen, Chris North, Arthur J Olson, James B Procter, David W Shattuck, Thomas Walter & Bang Wong
doi:10.1038/nmeth.f.301



Reviews

Visualizing genomes: techniques and challenges ppS5 - S15

Cydney B Nielsen, Michael Cantor, Inna Dubchak, David Gordon & Ting Wang
doi:10.1038/nmeth.1422


Visualization of multiple alignments, phylogenies and gene family evolution ppS16 - S25

James B Procter, Julie Thompson, Ivica Letunic, Chris Creevey, Fabrice Jossinet & Geoffrey J Barton
doi:10.1038/nmeth.1434

Visualization of image data from cells to organisms ppS26 - S41

Thomas Walter, David W Shattuck, Richard Baldock, Mark E Bastin, Anne E Carpenter, Suzanne Duce, Jan Ellenberg, Adam Fraser, Nicholas Hamilton, Steve Pieper, Mark A Ragan, Jurgen E Schneider, Pavel Tomancak & Jean-Karim Hériché
doi:10.1038/nmeth.1431

Visualization of macromolecular structures ppS42 - S55

Seán I O'Donoghue, David S Goodsell, Achilleas S Frangakis, Fabrice Jossinet, Roman A Laskowski, Michael Nilges, Helen R Saibil, Andrea Schafferhans, Rebecca C Wade, Eric Westhof & Arthur J Olson
doi:10.1038/nmeth.1427

Visualization of omics data for systems biology ppS56 - S68

Nils Gehlenborg, Seán I O'Donoghue, Nitin S Baliga, Alexander Goesmann, Matthew A Hibbs, Hiroaki Kitano, Oliver Kohlbacher, Heiko Neuweger, Reinhard Schneider, Dan Tenenbaum & Anne-Claude Gavin
doi:10.1038/nmeth.1436

diumenge, 21 de març del 2010

La historia de l'ós polar

Aquests dies és notícia la recent seqüenciació del DNA mitocondrial d'un ós polar (Ursus maritimus). La notícia no tindria tanta repercussió si no fos pel fet que el DNA es va extreure d'una mandíbula parcialment fossilitzada trobada a Noruega al 2004 i d'una antiguitat de 110.000–130.000 anys.

Segons el comunicat de premsa de l'equip investigador, es tracta de la seqüència de DNA mitocondrial més antiga d'un mamífer que s'ha seqüenciat fins al moment. La seqüenciació del DNA mitocondrial es descriu en l'article publicat a la revista Proceedings of the National Academy of Sciences (PNAS) i posa de manifest que l'ós polar és una espècie relativament recent (va divergir fa uns 150.000 anys de l'actual ós bru) que es va adaptar molt ràpidament a l'entorn de l'àrtic. Es podrà adaptar aquesta espècie al canvi climàtic causat per la humanitat? Esperem que aquesta seqüència de DNA no passi a ser una seqüència d'una espècie extingida.

dijous, 4 de març del 2010

Com definirieu Ciència?

Tot i que aquest vídeo el podeu trobar en altres blogs, el meu primer impuls ha estat penjar-lo també aquí. Es tracta d'un dels vídeos creats en la iniciativa anomenada "Symphony of Science".




[Michael Shermer]
Science is the best tool ever devised
For understanding how the world works

[Jacob Bronowski]
Science is a very human form of knowledge
We are always at the brink of the known

[Carl Sagan]
Science is a collaborative enterprise
Spanning the generations
We remember those who prepared the way
Seeing for them also

[Neil deGrasse Tyson]
If you're scientifically literate,
The world looks very different to you
And that understanding empowers you

Refrain:
[Richard Dawkins]
There's real poetry in the real world
Science is the poetry of reality

[Sagan]
We can do science
And with it, we can improve our lives

[Jill Tarter]
The story of humans is the story of ideas
That shine light into dark corners

[Lawrence Krauss]
Scientists love mysteries
They love not knowing
[Richard Feynman]
I don't feel frightened by not knowing things
I think it's much more interesting

[Brian Greene]
There's a larger universal reality
of which we are all a part

[Stephen Hawking]
The further we probe into the universe
The more remarkable are the discoveries we make

[Carolyn Porco]
The quest for the truth, in and of itself,
Is a story that's filled with insights

(Refrain)

[Greene]
From our lonely point in the cosmos
We have through the power of thought
Been able to peer back to a brief moment
After the beginning of the universe

[PZ Myers]
I think that science changes the way your mind works
To think a little more deeply about things

[Dawkins]
Science replaces private predjudice
With publicly verifiable evidence
(Refrain)


Altres vídeos de Symphony of Science:

dijous, 18 de febrer del 2010

L'ADN de Tutankamon

Aquests dies és notícia Tutankamon i les anàlisis de DNA que s'han fet per determinar la causa de la seva mort i establir les relacions genealògiques entre diverses mòmies. Els titulars dels articles dels diaris així ho reflexen. Per exemple: "El ADN de Tutankamón revela que murió de una enfermedad ósea relacionada con la malaria", "Nefertiti no era la madre del rey" o "El paludismo contribuyó a la muerte de Tutankamón, según un estudio de su ADN".

Els resultats dels anàlisis d'ADN ha portat sorpreses, com per exemple que els seus pares eren possiblement germans o que la seva mare no era Nefertiti, i ha permès obtenir una possible relació genealògica entre diverses mòmies:



Tot i que no hi ha cap novetat científica important en la notícia (no ha estat la primera mostra de "DNA antic" que s'ha extret i analitzat i per exemple la notícia recent de la seqüenciació del genoma humà d'un esquimal que va viure fa uns 4000 anys era científicament més novedosa), penso que s'ha perdut una molt bona oportunitat per fer una mica de difusió científica. En les notícies s'esmenta que tot aquest nou coneixement ha estat gràcies a l'anàlisi del DNA, però de quina mena d'anàlisi parlen? Sembla que haguin extret el DNA de les mòmies (això sí que queda prou clar), l'haguin possat en un barret i oh màgia! tenim les relacions genealògiques de les mòmies. A veure si podem profunditzar una mica més:

La clau per establir les relacions genealògiques ha estat l'estudi de les variacions que dins del genoma humà trobem entre diferents individus. En concret, s'han estudiat diverses variacions conegudes amb el nom de microsatèl·lits, que s'han utilitzat com a marcadors genètics. Podem definir un microsatèl·lit com una seqüència de DNA en les que un fragment, que pot anar des de 1 a 6 nucleòtids, es repeteix diverses vegades, de manera consecutiva. La variació del nombre de vegades que es repeteix pot variar entre individus i es pot utilitzar per establir si existeix una relació pare/mare-fill/a entre dos individus. Com que tenim 2 còpies de tots els cromosomes (un que heretem del pare i l'altre de la mare), el nombre de repeticions en un microsatèlit també l'hem heretat dels nostres progenitors, que el van heretar dels nostres avis, i així successivament. Per saber el nombre de repeticions que un individu té en un determinat microsatèl·lit només cal extreure una mostra de DNA (es pot treure d'un ós, pel, ...) i amplificar mitjançant una PCR la regió que conté les repeticions, utilitzant uns o encebadors primers.



En el cas de Tutankamon s'han utilitzat 8 microsatèl·lits i en la figura següent podem veure el nombre de repeticions de cada mòmia en cada microsatèl·lit:



Amb aquesta informació es pot fer una possible genealogia i establir que el pare de Tut (Akhenaten) i la seva mare (la mòmia KV35YL) possiblement eren germans:


El treball amb DNA antic es especialment dificultós. El DNA al cap dels anys es va trencant i el que s'obté són fragments petits, que dificulten l'assaig. Hi ha també el problema de la contaminació. Com es pot estar segur de que realment estem obtenint el DNA, en aquest cas de la mòmia, i no per exemple dels investigadors que fan l'anàlisi i que podrien haver contaminat la mostra. És per això que en aquest tipus d'anàlisi cal ser molt curós. Per a que un resultat segui creïble, cal repetir molts cops els assajos i comprovar que sempre surt el mateix. Normalment els assajos es fan simultàniament en dos laboratoris diferents, utilitzant investigadors diferents. Fins i tot cal analitzar el DNA dels investigadors per descartar contaminacions.

Article original: Z. Hawass et al. Ancestry and Pathology in King Tutankhamun's Family. JAMA. 2010;303(7):638-647.

divendres, 18 de desembre del 2009

Tanquem l'any Darwin amb regals ....

Per acabar l'any Darwin algunes idees per fer un regal "evolutiu". N'hi ha per totes les edats i gustos. Bé, per tots els gustos (creacionistes o IDiots) potser no. Extret de l'"Evolver Zone", a resource for students, teachers, and researchers with an interest in evolution.





















dissabte, 12 de desembre del 2009

Gadgets sobre Bioinformatica

Aquí van una serie de Gadgets sobre Bioinformàtica molt útils desenvolupats per Your Lab Data.


DNA to Protein

Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.



Sequence Manipulation

The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.

Protein to DNA

Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.


Palindromic sequences finder

Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences.

Restriction digest of DNA

Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).

Sequence:
Show code
Min. recognition size for each enzyme
Type of restriction enzyme
Use only this endonuclease

Only use enzymes with known bases (no N,R,Y...)
Include Type IIb restriction enzymes
Include Type IIs restriction enzymes
When two or more input sequences are searched:
Show only endonucleases showing different restriction patterns for searched sequences.

Reverse Complement Gadget


Reverse Complement - Bioinformatics Tools



Description:"Reverse Complement - Bioinformatics Tools" Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.
Author: Your Lab Data

Melting Temperature (Tm) calculator

This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.



Microsatellite Repeats Finder

This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.


In Silico PCR Amplification

In Silico PCR Amplification




Description: Simulation of PCR amplification. Allows one mismatch between primer and template.
Author: Your Lab Data

Primer3 (Basic Edition)

Primer3 (Basic Edition)




Description:Primer3 is a widely used program for designing PCR primers (PCR = 'Polymerase Chain Reaction'). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.
Author: Your Lab Data