dissabte, 12 de desembre de 2009

Gadgets sobre Bioinformatica

Aquí van una serie de Gadgets sobre Bioinformàtica molt útils desenvolupats per Your Lab Data.


DNA to Protein

Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.



Sequence Manipulation

The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.

Protein to DNA

Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.


Palindromic sequences finder

Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences.

Restriction digest of DNA

Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).

Sequence:
Show code
Min. recognition size for each enzyme
Type of restriction enzyme
Use only this endonuclease

Only use enzymes with known bases (no N,R,Y...)
Include Type IIb restriction enzymes
Include Type IIs restriction enzymes
When two or more input sequences are searched:
Show only endonucleases showing different restriction patterns for searched sequences.

Reverse Complement Gadget


Reverse Complement - Bioinformatics Tools



Description:"Reverse Complement - Bioinformatics Tools" Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.
Author: Your Lab Data

Melting Temperature (Tm) calculator

This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.



Microsatellite Repeats Finder

This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.


In Silico PCR Amplification

In Silico PCR Amplification




Description: Simulation of PCR amplification. Allows one mismatch between primer and template.
Author: Your Lab Data

Primer3 (Basic Edition)

Primer3 (Basic Edition)




Description:Primer3 is a widely used program for designing PCR primers (PCR = 'Polymerase Chain Reaction'). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.
Author: Your Lab Data