dilluns, 29 de setembre de 2008

DNA d'espècies extingides


Es possible obtenir el DNA d'espècies extingides? Doncs sí. És pot fer a partir de fòssils o mostres d'animals de museus (si són espècies que s'han extingit fa poc com el Tigre de Tasmània). De fet hi ha una bona colla de seqüències de DNA d'espècies extingides en les bases de dades de seqüències. Aquí teniu un enllaç on podeu trobar aquestes seqüències. De fet hi ha un projecte en marxa liderat pel Dr. Svante Paabo del Max Planck Institute de Munich per seqüenciar el genoma complert dels Neardentals a partir de restes fòssils, trobades entre altres llocs a la cova de "El Sidrón" a Astúries.

I el DNA d'un dinosaure? Coneixeu l'argument de "Jurassic Park", oi? A partir dels mosquits retinguts a l'interior d'un ambre fossilitzat, un grup de científics es capaç d'extreure el DNA de diverses espècies de dinosaures i clonar-los. El que potser no sabreu és que en el llibre, l'autor Michael Crichton va incloure una seqüència de DNA, suposadament de dinosaure.



És realment aquesta seqüència de DNA de dinosaure? Com ho podríem saber? Ja us he esmentat en algun altre post que existeix una eina bioinformàtica, anomenada blast, per comparar una seqüència de DNA o proteïna amb totes les seqüències fins ara conegudes i que trobem en les bases de dades de seqüències. Que passa si comparem la seqüència suposadament de dinosaure que apareix al llibre de Jurassic Park amb les bases de dades de seqüències de DNA? Doncs això és el que va fer en Mark Boguski al 1992. Si ho feu trobareu que no es tracta d'una seqüència real de dinosaure, si no que es tracta d'una seqüència derivada del plàsmid pBR322 (una seqüència de DNA creada per l'home i molt utilitzada en Biotecnologia). En Mark va publicar la seva troballa a la revista Biotechniques.

La història però continua. Resulta que l'autor de Jurassic Park, Michael Crichton, va veure l'article i va escriure a en Mark dient-li que efectivament no es tractava del DNA d'un dinosauri i que no s'hagués pensat mai que algú mai ho comprovaria. També li deixava anar que si algú li proposava una seqüència de DNA real de dinosaure, l'incorporaria en altres edicions del llibre. En Mark va acceptar el repte i va preparar una seqüència suposadament de dinosaure. Aquesta seqüència va aparèixer en la segona part de la saga, titulada "El mundo perdido". Si feu un blast d'aquesta seqüència de DNA, descobrireu que és més possible que sigui de dinosaure, doncs a les seqüències que més s'assembla són dues seqüències de pollastre i granota (és el que s'esperaria trobar si partim de la hipòtesis de que els dinosaures estaven emparentats amb els rèptils i aus). En Mark, però va introduir un missatge ocult en aquesta seqüència de DNA. Si traduïm a proteïna i comparem la seqüència resultant amb la proteïna de pollastre que era la més semblant, descobrireu el missatge MARK WAS HERE NIH que traduït al català seria "En Mark ha estat aquí, NIH" (NIH són els National Institute of Health on treballava).



Aquesta història és la que tenia pendent explicar-vos en un dels meus posts anteriors sobre "missatges ocults en els genomes".

dissabte, 27 de setembre de 2008

Premis i competicions cientifiques (ii)


Seguint amb els premis i competicions científiques, en concret amb els anomenats X Prize. La X Prize Foundation acaba d’engegar una competició en la que tots hi podeu participar. Es titula “What’s Your Crazy Green Idea?” (Quina és la teva boja i verda idea) i es tracta d'elaborar un vídeo de 2 minuts màxim de durada proposant com hauria de ser el proper premi X prize sobre Energia i medi ambient (Energy and Environment). És a dir, es tracta de proposar que cal promoure (quina recerca, desenvolupament tecnològic, ....) per millorar en aquest camp. Els vídeos dels participants són penjats al YouTube i teniu temps fins el 31 d’Octubre per a participar-hi. El premi 25,000$. Aquí us deixo un vídeo explicatiu de la competició.



Ja hi ha alguns vídeos penjats, encara que alguns no han entès bé de que es tracta.

Sort si participeu.

dijous, 25 de setembre de 2008

Ciencia amb humor 1


Comencem una nova secció titulada Ciència amb humor on anirem penjant dibuixos (cartoons) relacionats amb la ciència.

Aquí us deixo el primer, relacionat amb el post on parlàvem dels tests genètics.

La vinyeta representa una entrevista de feina de l'any 2010. L'entrevistador li explica que dels resultats del test genètic veuran la seva predisposició a algunes malalties i que estan treballant en trobar el gen de "treballar moltes hores i cobrar poc".

dilluns, 22 de setembre de 2008

Tests genetics


El dia 9 de Setembre la companyia 23andMe ha anunciat una baixada de preus, des de 999$ fins 399$, del servei que ofereixen. Aquest servei no és altre que un test genètic. A través d'una mostra de saliva que s'envia a la companyia, t'envien els resultats d'un test genètic que et mostra entre altres coses: susceptibilitats de patir alguna de les malalties que tenen un cert component genètic, informació sobre els teus ancestres (si tens per exemple una variant en una part del teu genoma que per exemple és més comú entre els esquimals), comparació del teu DNA amb familiars o amics que també s'han fet el test, i altre informació que es pot extreure de l'anàlisi del DNA d'una persona. En el blog del Pere Estupinyà, ja ens explicava que recentment l'empresa havia organitzat una festa on anava recollint mostres de saliva dels convidats il·lustres i els hi regalava els resultats del seu test. L'empresa 23andMe és propietat de la dona d'un dels fundadors de Google, Sergey Brin. Doncs fa tres dies que en el mateix blog del Sergey Brin, aquest anuncia que s'ha fet un dels tests genètics de la companyia i que els resultats mostren que té una mutació, la G2019S, en el gen LRRK2 que el predisposa a patir la malaltia de Parkinson, com pateix la seva mare. Ell explica que es va fer el test com a diversió i que no s'esperava que li donessin una notícia com aquesta. En aquest cas, com molts altres resultats d'aquests tests genètics, el resultat només és una predisposició més alta de l'habitual a patir una determinada malaltia. Cal no treure de context els resultats d'aquests tipus de test i que t'ho expliquin molt bé. Aquest tipus de notícies són difícils de pair i hi ha gent que segur no ho vol saber (de moment no hi ha cura per moltes d'aquestes malalties i a més pots tenir una variant que predisposa per una malaltia i no desenvolupar-la). El creador de Google, Sergey Brin, s'ho ha pres bé. Diu que considera que és una sort que disposi d'aquesta informació, doncs a partir d'ara es podrà preparar. De ben segur que a partir d'ara els diners dedicats a la recerca d'aquesta malaltia augmentaran. Podeu llegir la notícia a la web de Scientific American.

La companyia 23andMe no és l'única que ofereix aquests serveis. Altres companyies que ofereix aquests serveis són la companyia Islandesa deCODE genetics amb el seu servei anomenat deCODEme i les companyies Navigenics i DNAdirect.
Per finalitzar us deixo un vídeo que a mi m'ha agradat molt, explicant els resultats que et donen aquests tipus de tests (altre informació relacionada la trobareu aquí):


diumenge, 21 de setembre de 2008

La importància d'ensenyar a pensar (ii)


Us deixo una altra anècdota científica. Aquesta l'he tret d'un blog sobre educació infantil.
Richard Feynman, premi nobel de física, explicava la influència que havia tingut el seu pare, en el seu desenvolupament com a científic amb la següent anècdota:
Entre els veïns sempre es comentava que ell era tan espavilat perquè el seu pare constantment li estava ensenyant coses. Un dia, mentre jugava amb un amic al jardí, l’amic li diu: Mira quin ocell, com es diu? Richard li contesta: Ni idea! i l’amic sorprès li demana: Què no t’ensenya res, el teu pare? I sí. El seu pare li havia ensenyat i li havia parlat de l’ocell; però d’una altra manera.
Veus aquell ocell? és un “Spencer’s warbler” (em sembla que s’inventava el nom) en italià es diu Chutto Lapittida; en portuguès, és un Bom da Peida, en xinès és un Chung-long-tah .......... Podries saber el nom d’aquest ocell en tots els idiomes del món, però quan els haguessis après no sabries res més de l’ocell. Així que observa l’ocell i mira el que està fent i fes-te preguntes. Això és el que compta! D’aquesta manera el meu pare em mostrava la diferència entre només saber el nom de les coses i saber coses.

dimecres, 17 de setembre de 2008

Missatges ocults en els genomes

Podem representar l'ADN o molècula portadora de la informació genètica que es transmet de pares a fills, com una seqüència de quatre tipus de lletres (A,C,G,T) anomenades bases. L'ordre de les lletres és el que dóna sentit al missatge i permet el fenomen complex de la vida. Principalment aquest missatge contingut en l'ADN només serveix per a sintetitzar un altre tipus de molècules, les proteïnes, que són les que fan les "funcions" en les cèl·lules. Les proteïnes estan formades per la unió d'aminoàcids. Hi han 20 aminoàcids diferents (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y representat en aquest cas per la inicial del seus noms), i l'ordre en que cal ajuntar els aminoàcids per formar una determinada proteïna és el que està "codificat" en l'ADN com informació que es transmet de generació en generació. La clau per desxifrar o passar de l'ADN a la proteïna és que cada tres bases corresponen a un aminoàcid determinat. Així, donada una seqüència d'ADN, es genera una seqüència determinada d'una proteïna.

Si representem doncs una molècula d'ADN com una seqüència de les lletres A,C,G,T i una proteïna com una seqüència de (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y podem jugar una mica amb els missatges en la nostra llengua que s'originen. Una seqüència dels quatre tipus de lletres (A,C,G,T) com és l'ADN no dóna gaire joc. Es poden formar paraules com CACA o TATA i poca cosa més. En canvi les seqüències de proteïnes donen molt més joc. Si tenim la sort que les lletres que formen el nostre nom coincideixen amb algun dels 20 aminoàcids (per exemple SANTI o VALLVE són possibles, però no ALBERT doncs no hi ha cap aminoàcid que comenci per la lletra B) podem encriptar el nostre nom o transformar-lo en una seqüència d'ADN. Per fer-ho només hem de saber quina correspondència hi ha entre les agrupacions de 3 bases amb cada aminoàcid. Això se'n diu codi genètic.
Taula amb el codi genètic:

Així per exemple SANTI el podríem transformar en TCTGCAAACACCATT (hi ha altres variants doncs hi han agrupacions de tres lletres que donen lloc al mateix aminoàcid).
Aquí teniu una petita aplicació que permet transformar una seqüència de proteïnes en una d'ADN:


I aquí una que us permet transformar una seqüència d'ADN en una de proteïnes:


Aquest joc és el que ha permès a alguns investigadors deixar "missatges ocults" o empremtes en alguna seqüència d'ADN. Aquí en teniu dos casos:

  • Aquest mateix any hem viscut una fita important en el camp que s'anomena biologia sintètica. Consisteix en sintetitzar químicament molècules d'ADN amb les característiques desitjades. Portat a l'extrem, podria significar sintetitzar el genoma (conjunt de tot l'ADN) d'un organisme i crear així noves espècies. Doncs és el que va fer el grup del Dr. Craig Venter del J Craig Venter Institute (Podeu llegir la notícia en un dels posts del blog del llindar). Va sintetitzar i empalmar químicament unes 580.000 bases d'ADN per formar el genoma d'un bacteri. En aquest cas, només va copiar íntegrament el genoma del primer bacteri que es va seqüenciar completament. Va introduir però 5 missatges ocults en forma de fragments d'ADN. Aquests fragments són: "gtagaaaaca ccgaacgaattaattctacgattaccgtgactgag", "tgtcgtgcaattggagtagagaacacagaacga", "catgcaatgtcgatgattacccac", "ggtctagctagtagcgcgaatgactgcctatacgatgag" i "tgcataaacg acatcgctaatgactgtctttatgatgaa". Si els tradueixes a proteïna trobaràs els missatges ocults. Cal dir que l'asimetrich ho va encertar de ple en un dels seus comentaris del post del llindar.
  • El segon exemple es mereix un post per ell sol que us explicaré un altre dia. Només us avanço que en un fragment d'ADN suposadament de dinosauri que apareix en la novel·la "El mundo perdido" de Michael Crichton, apareix el missatge ocult "MARK HAS HERE NIH".


La utilització d'altres eines bioinformàtiques més complexes, permet altres tipus de "jocs" més elaborats. Per exemple, existeixen eines (una d'elles es diu BLAST) per comparar una seqüència d'una proteïna amb les seqüències d'altres proteïnes ja conegudes i trobar així semblances. Podem agafar un nom, i per exemple buscar en quines proteïnes el trobem. Per exemple si fem un Blast del nom "VALLVE" trobem aquest fragment de seqüència en proteïnes de moltes espècies. Per exemple la mosca, bacteris i fins i tot en l'home. Si restringim a proteïnes humanes obtenim 28 proteïnes que contenen aquesta seqüència de lletres. Ara que no totes les cerques d'aquest tipus que podem fer donen un resultat tan bo com si busqueu el nom "SARAHPALIN" (Sarah Palin, el nom de la ultraconservadora republicana que es presenta com a vicepresidenta). La seqüència a la que més s'assembla el nom de "SARAHPALIN" és una proteïna del fong Botryotinia fuckeliana (Només cal que traduïu la paraula anglesa fuck per entendre la gràcia). Podeu llegir la història en el següent blog.

dissabte, 13 de setembre de 2008

La ciència dels castells (ii)


Ara que s'apropa Santa Tecla, tornem a reprendre el tema de la ciència dels castells. La veritat és que és un tema poc explorat i que podria donar molt de si. Malauradament no disposo dels coneixements per fer-ho, però tot i això, no em resisteixo a parlar-ne. Sabeu quan pot arribar a pesar un castell? Doncs bé, per exemple el tronc d'un hipotètic tres de deu dels Xiquets de Tarragona (un dels castells més alts que s'han fet) pot pesar de l'ordre dels 1325 Kg, i s'hi afegim el pes de la gent del folre i les manilles, obtenim un total de més de vuit tones de pes sobre una pinya. Què us sembla? Sorprenen oi? I un casteller, quan de pes suporta? Per exemple un segon d'un castell de vuit pisos té uns 200 quilos damunt seu. Això però seria si el castell restés completament "parat". Els castells però es mouen i això provoca que en moments puntuals els castellers estan sotmesos a encara més pes. Evidentment que les oscil·lacions del castell a on més es noten és als pisos de dalt. Així per exemple una oscil·lació de 10 cm a nivells de quarts pot significar entre 20 i 40 cm per a l'acotxador. Les estrebades del casteller quan pugen i baixen també afegeixen noves tensions a l'estructura, per això a la canalla sempre si li diu "puja ben finet". A quina alçada pot estar un enxaneta? Doncs per exemple en un castell de nou pot estar a més de 9 metres. Sembla estrany doncs que quan cauen no es facin més mal. Estudis biomecànics han demostrat que la caiguda d'un castell és molt diferent a una caiguda lliure. Mentre cauen hi ha diversos mecanismes de frenada com els petits cops que es van donar durant el trajecte de caiguda contra altres castellers del tronc. L'esforç físic requerit pot passar factura als castellers, però l'estrès o emoció provocats poden afectar també al públic. El percentatge de persones que sobrepassen la seva freqüència cardíaca màxima teòrica pot ser major entre el públic que entre els mateixos castellers. El nombre de lesions, en funció de les hores de dedicació, són equiparables o estan per sota dels observats en altres activitats com el futbol, el bàsquet, l'handbol o la mateixa activitat escolar.
Totes aquestes dades i més les trobareu a l'excel·lent llibre "Manual de supervivència del casteller. La Ciència al servei de les torres humanes" de Jaume Roset i Llobet, col·lecció l'aixecador, edicions Cossetània.
Sort per Santa Tecla castellers.

dimarts, 9 de setembre de 2008

Operació immortalitat

He estat pensant si havia de fer aquest post o no, doncs no m'agrada donar difusió a segons quines iniciatives que el que persegueixen es precisament això, i en aquest cas amb una iniciativa comercial al darrera. Per això no tindre gaire cura en posar el nom dels personatges involucrats o alguns dels detalls. Em centraré en el què m'ha portat a escriure-ho en aquest blog.

Resulta que hi ha un mil·lionari que té una empresa de videojocs que el proper mes d'octubre serà el sisè turista espacial. Suposo que per amortitzar una part del que deu haver pagat pel viatge, ha decidit treure una mica de publicitat, sobretot per al seu últim videojoc. La iniciativa es diu "Operation Immortality". Diu que s'emportarà amb ell, per deixar a l'Estació Espacial Internacional, un llistat de les conquestes més importants que ha fet la humanitat per si de cas la humanitat desapareix. La cosa és bastant absurda, més si veus quin tipus de preguntes fa a l'enquesta de la seva pàgina web, suposo que per decidir què és el que s'ha d'emportar. Preguntes com quina és la millor cançó que s'ha escrit mai, quina és la millor pel·lícula, el millor actor, .... També, i ara bé el que ens interessa, diu que s'emportarà "mostres digitalitzades" del DNA de les persones més importants de la terra. En aquest punt, fixeu-vos el que diu "We have sent requests for DNA to the world's brightest minds, most powerful bodies, and cultural standouts". Algú de vosaltres heu rebut la petició? No? No patiu encara teniu alguna oportunitat. Entre els jugadors del videojoc que ho sol·licitin, es faran diversos sortejos per triar-ne 48 que seran afegits al projecte. Anem pels detalls tècnics. Digitalitzar el DNA de cada individu vol dir seqüenciar el seu genoma, i així queda sobreentès en les condicions per participar en el concurs. Després però parlen de "DNA tests" i que els resultats seran encriptats i emmagatzemats en l'Estació Espacial durant un temps indeterminat. Per què carai els encripta si el que vol és que els extraterrestres ho puguin llegir? I això de durant un temps indeterminat sona a que quan torni del seu viatge, totes aquestes dades tornarà amb ell, no? Evidentment en les condicions per participar en el concurs deixar molt clar que els resultats de la digitalització del DNA no seran públics i que no els hi seran enviats a les persones que hagin donat les mostres. L'últim sorteig es farà el 29 de Setembre i el viatge se suposa que serà al mes d'octubre. El preu del premi diuen que equival a uns 100$ i que hi haurà 48 premis. Així doncs, el premi de seqüenciar un genoma per menys de 1000$ o en menys de 10 dies ja deu estar resolt, oi? Pels qui no domineu el tema, al 2001 d'una banda un consorci públic i d'una altra una empresa privada (Celera Genomics) van seqüenciar de forma independent el genoma humà (de fet el que es va obtenir al 2001 es va considerar un esborrany que no es va donar per acabat fins al 2003). En l'actualitat s'han seqüenciat completament els genomes de dos individus, James Watson i Craig Venter, però després de molts mesos de feina i de gastar diversos milers de dolars. Per això, digitalitzar el genoma dels participants amb el poc temps de que es disposa és tècnicament inviable, a part del preu prohibitiu que representaria.

Una iniciativa semblant, però científicament mes seriosa (sense la digitalització del DNA és clar) va ser el missatge, anomenat Golden Record, que al 1977 va portar el cohet Voyager. En el comitè científic que el va dissenyar hi havia el Carl Sagan, i el missatge contenia gravacions en diferents llengües (el català no hi era), "sons de la terra", i una selecció eclèctica de 90 minuts de música.

divendres, 5 de setembre de 2008

Premis i competicions cientifiques

Els científics són molt competitius. Els que s'imaginin que els científics són uns altruistes que fan les coses pel progrés de la humanitat s'equivoquen. Entre els científics hi ha molta competència i preocupa molt publicar en les millors revistes possibles per tenir un bon Currículum. La competència directa entre científics la trobem per exemple en les convocatòries per obtenir finançament. Un nombre cada cop més gran de grups d'investigadors demanen la subvenció dels seus projectes en convocatòries públiques i privades que tenen un pressupost limitat. També existeixen altres tipus de competicions o premis científics. En el camp de l'enginyeria són bastant espectaculars, tots haureu vist els partits de futbol entre robots o les curses de cotxes impulsats per energia solar. Algunes d'aquestes competicions són meres curiositats, alguns serveixen per comparar diverses estratègies i són realment útils i d'altres són més de "cara a la galeria". Aquí us deixo alguns dels premis i competicions de les que tinc coneixement, segur que n'hi ha però moltes més.

Un concurs molt curiós va ser el que es va desenvolupar durant les edicions del 2000 al 2002 dels meetings que organitza cada any el prestigiós Cold Spring Harbor Laboratory. El concurs, anomenat GeneSweep, consistia en acertar el nombre de gens que estan codificats en el genoma humà. Recordeu que al febrer del 2001 es van publicar els dos primers esborranys de la seqüència del genoma humà. Cada persona participant en les reunions anuals que el Cold Spring Harbor Laboratory organitzava sobre el genoma humà podia fer una aposta que escrivia en un llibre. El preu de l’aposta era de $1 l’any 2000, $10 l’any 2001 i $20 l’any 2002 (representa que cada any es tenia més informació i era més fàcil encertar-ho). El Premi consistia en els diners de les apostes i una copia dedicada per James Watson del seu llibre “The Double Helix”. El guanyador va ser una investigadora de Seattle, Lee Rowen, que al 2001 va predir que el nombre de gens era de 25.947 (aquesta va ser la estimació més baixa del nombre de gens i la que va guanyar). Encara que el premi en metàl·lic el van repartir en dues meitats de 1.140$. Una meitat del premi i la còpia signada del llibre d'en James Watson va ser per Lee Rowen, mentre que l'altra meitat se la van repartir Paul Dear (MRC Laboratory of Molecular Biology, Cambridge, England) que a l'any 2000 havia predit 27.462 gens i Olivier Jaillon (Genoscope-CNS, Paris, France) qui al 2001 va predir 26.500. Inicialment es pensava que el genoma humà codifica al voltant de 100.000 gens. Després s'ha anat reduint aquesta estimació i el nombre que es va estimar en el moment de fer públic el guanyador del concurs va ser 21.000. Encara ara però no sabem el nombre total.

CASP, Protein Structure Prediction: Es tracta d'una competició bianual que consisteix en que diversos grups que es dediquen a desenvolupar algoritmes per predir l'estructura tridimensional d'una proteïna a partir de la seva seqüència d'aminoàcids es reuneixen i fan una predicció d'una estructura d'una proteïna que ha estat obtinguda experimentalment però que no ha estat dipositada en les bases de dades públiques. Aquest tipus de competicions serveixen per avaluar l'estat actual de la metodologia existent i comparar diverses estratègies o algoritmes per resoldre un problema concret.

Entre altres competicions d'un format similar a l'anterior trobem CAPRI: Critical Assessment of PRediction of Interactions que el defineixen com "a community wide experiment on the comparative evaluation of protein-protein docking for structure prediction", The BioCreAtIvE (Critical Assessment of Information Extraction systems in Biology) el defineixen com "a challenge evaluation that consists of a community-wide effort for evaluating text mining and information extraction systems applied to the biological domain", o CAMDA: Critical Assessment of Microarray Data Analysis,

Durant l'any 2005 i com a part del projecte ENCODE, es va fer a Cambridge un workshop de dos dies de durada on 18 equips provinents de diferents laboratoris d'arreu del món van fer una competició per veure quin equip era capaç de fer una millor predicció de la localització dels gens d'una porció determinada del genoma humà. Els resultats van posar de manifest que els mètodes automàtics d'anotació de gens no són capaços encara de reproduir el resultat d'anotadors manuals. L'estàndard en anotació de gens, que és el que es va utilitzar en el projecte ENCODE, és un grup d'anotadors manuals del Sanger Center de Cambridge, UK que s'anomenen HAVANA group.

Archon Genomics X Prize: Va se creat al 2006 i forma part la sèrie dels X Prizes amb 10 milions de dolars de premi per l'equip que sigui capaç de desenvolupar una metodologia que li permeti seqüenciar 100 genomes complerts humans en 10 dies amb un preu de no més 10.000$ per genoma. Aquest premi deriva d'un premi anterior (del 2003) proposat per la Craig Venter Foundation on s'establia un premi de 500.000$ a qui fes els avanços tècnics que permetessin seqüenciar un genoma complert humà per un preu de 1.000$ com a màxim. Els dos premis encara estan deserts.

Aquí teniu un vídeo que explica aquest primer premi:


Google Lunar X Prize: creat el 13 de setembre del 2007 i patrocinat per Google. El premi consisteix en 30 milions de dolars que s'emportarà l'empresa privada que aconsegueixi fer aterrar un robot a la lluna i que sigui capaç de portar terme una sèrie de missions com desplaçar-se almenys 500 metres o enviar imatges i dades a la terra.

Us animeu a participar??

dimarts, 2 de setembre de 2008

La ciència de la cervesa light

Fa pocs mesos una marca de cerveses (no dic el nom per no fer propaganda) ha tret al mercat espanyol una cervesa light (no confondre amb les cerveses sense alcohol o cerveses 0,0). La idea no és nova doncs crec que fa anys ja n'hi havia alguna i a més ja porten un temps en el mercat americà. La veritat és que la noció d'una cervesa light és bastant absurda. Però en què consisteix una cervesa light? Molt breument el procés d'elaboració de la cervesa consisteix en deixar que l'ordi (barley en anglès) germini i es transformi en malta. En aquest procés es sintetitzen una sèrie d'enzims hidrolítics que en les fases posteriors de l'elaboració de la cervesa s'encarreguen d'hidrolitzar el midó i altres sucres de la malta en sucres més senzills (com glucosa i maltosa) que els llevats, a través de la fermentació alcohòlica, són capaços de transformar en etanol. En la cervesa ja acabada sempre queden una sèrie de sucres residuals que els llevats no han estat capaços de metabolitzar. Doncs bé, la idea de la cervesa light és transformar enzimàticament (afegint enzims abans de la fermentació) aquests sucres en sucres fermentables que els llevats siguin capaços de transformar en etanol. S'aconsegueix així cerveses de baixa atenuació amb un contingut baix en carbohidrats en el producte final.

Tindrien aquestes cerveses menys calories que les cerveses tradicionals? La resposta és que aquestes cerveses atenuades tenen més grau alcohòlic doncs s'ha obtingut més etanol, i la quantitat de calories no és gaire diferent d'una cervesa convencional (l'etanol també aporta calories, veieu la taula adjunta). Què cal fer doncs per tenir una cervesa light que aporti menys calories? Doncs rebaixar també el grau alcohòlic d'aquestes cerveses atenuades (és a dir fer-les més diluïdes). De fet la cervesa light que es ven aquí té la meitat d'alcohol que les cerveses normals. S'aconsegueix així una cervesa amb menys calories que una cervesa tradicional, però fixeu-vos que la diferència no és gaire significativa. Per això les calories que t'estalvies amb una cervesa light són ridícules, és com allò de fer un gran tiberi i després demanar un tallat amb sacarina. El gust i l'aroma de la cervesa també es veuen alterades com explica el link següent.

La realitat però és que la cervesa light i les cerveses baixes en carbohidrats (les cerveses light solen tenir un contingut en carbohidrats entre 10-20 g/l mentre que les cerveses baixes en carbohidrats tenen un contingut aproximat de 7,5 g/l) als EEUU està creixent cada vegada més en vendes (veieu el gràfic adjunt). Per què doncs aquest creixement? L'explicació és que als EEUU fa temps que està de moda la dieta Atkins (i altres dietes semblants) que recomanen reduir considerablement la ingesta de carbohidrats. Així la gent que segueix aquestes dietes es veu una cervesa light o baixa en carbohidrat i té la consciència ben tranquil·la. Com veieu, el que es posa de moda o es ven bé, quasi sempre respon a factors molt poc científics.
Per acabar aquest post us deixo amb un parell d'anuncis divertits de cervesa light.
Salut.


Després d'escriure aquest post he trobat la notícia de la comercialització d'una cervesa elaborada amb un llevat de 45 milions d'antiguitat que ha estat extret d'un fragment d'ambre (ámbar en castellà). La cervesa es diu Fossil fuels i la comercialitza l'empresa Fossil Fuels Brewing Co que l'ha presentat en societat en la Fossil Fuels Launch Party. Aquí teniu un link a la notícia. Un bon muntatge comercial, no creieu?