dimecres, 17 de setembre de 2008

Missatges ocults en els genomes

Podem representar l'ADN o molècula portadora de la informació genètica que es transmet de pares a fills, com una seqüència de quatre tipus de lletres (A,C,G,T) anomenades bases. L'ordre de les lletres és el que dóna sentit al missatge i permet el fenomen complex de la vida. Principalment aquest missatge contingut en l'ADN només serveix per a sintetitzar un altre tipus de molècules, les proteïnes, que són les que fan les "funcions" en les cèl·lules. Les proteïnes estan formades per la unió d'aminoàcids. Hi han 20 aminoàcids diferents (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y representat en aquest cas per la inicial del seus noms), i l'ordre en que cal ajuntar els aminoàcids per formar una determinada proteïna és el que està "codificat" en l'ADN com informació que es transmet de generació en generació. La clau per desxifrar o passar de l'ADN a la proteïna és que cada tres bases corresponen a un aminoàcid determinat. Així, donada una seqüència d'ADN, es genera una seqüència determinada d'una proteïna.

Si representem doncs una molècula d'ADN com una seqüència de les lletres A,C,G,T i una proteïna com una seqüència de (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y podem jugar una mica amb els missatges en la nostra llengua que s'originen. Una seqüència dels quatre tipus de lletres (A,C,G,T) com és l'ADN no dóna gaire joc. Es poden formar paraules com CACA o TATA i poca cosa més. En canvi les seqüències de proteïnes donen molt més joc. Si tenim la sort que les lletres que formen el nostre nom coincideixen amb algun dels 20 aminoàcids (per exemple SANTI o VALLVE són possibles, però no ALBERT doncs no hi ha cap aminoàcid que comenci per la lletra B) podem encriptar el nostre nom o transformar-lo en una seqüència d'ADN. Per fer-ho només hem de saber quina correspondència hi ha entre les agrupacions de 3 bases amb cada aminoàcid. Això se'n diu codi genètic.
Taula amb el codi genètic:

Així per exemple SANTI el podríem transformar en TCTGCAAACACCATT (hi ha altres variants doncs hi han agrupacions de tres lletres que donen lloc al mateix aminoàcid).
Aquí teniu una petita aplicació que permet transformar una seqüència de proteïnes en una d'ADN:


I aquí una que us permet transformar una seqüència d'ADN en una de proteïnes:


Aquest joc és el que ha permès a alguns investigadors deixar "missatges ocults" o empremtes en alguna seqüència d'ADN. Aquí en teniu dos casos:

  • Aquest mateix any hem viscut una fita important en el camp que s'anomena biologia sintètica. Consisteix en sintetitzar químicament molècules d'ADN amb les característiques desitjades. Portat a l'extrem, podria significar sintetitzar el genoma (conjunt de tot l'ADN) d'un organisme i crear així noves espècies. Doncs és el que va fer el grup del Dr. Craig Venter del J Craig Venter Institute (Podeu llegir la notícia en un dels posts del blog del llindar). Va sintetitzar i empalmar químicament unes 580.000 bases d'ADN per formar el genoma d'un bacteri. En aquest cas, només va copiar íntegrament el genoma del primer bacteri que es va seqüenciar completament. Va introduir però 5 missatges ocults en forma de fragments d'ADN. Aquests fragments són: "gtagaaaaca ccgaacgaattaattctacgattaccgtgactgag", "tgtcgtgcaattggagtagagaacacagaacga", "catgcaatgtcgatgattacccac", "ggtctagctagtagcgcgaatgactgcctatacgatgag" i "tgcataaacg acatcgctaatgactgtctttatgatgaa". Si els tradueixes a proteïna trobaràs els missatges ocults. Cal dir que l'asimetrich ho va encertar de ple en un dels seus comentaris del post del llindar.
  • El segon exemple es mereix un post per ell sol que us explicaré un altre dia. Només us avanço que en un fragment d'ADN suposadament de dinosauri que apareix en la novel·la "El mundo perdido" de Michael Crichton, apareix el missatge ocult "MARK HAS HERE NIH".


La utilització d'altres eines bioinformàtiques més complexes, permet altres tipus de "jocs" més elaborats. Per exemple, existeixen eines (una d'elles es diu BLAST) per comparar una seqüència d'una proteïna amb les seqüències d'altres proteïnes ja conegudes i trobar així semblances. Podem agafar un nom, i per exemple buscar en quines proteïnes el trobem. Per exemple si fem un Blast del nom "VALLVE" trobem aquest fragment de seqüència en proteïnes de moltes espècies. Per exemple la mosca, bacteris i fins i tot en l'home. Si restringim a proteïnes humanes obtenim 28 proteïnes que contenen aquesta seqüència de lletres. Ara que no totes les cerques d'aquest tipus que podem fer donen un resultat tan bo com si busqueu el nom "SARAHPALIN" (Sarah Palin, el nom de la ultraconservadora republicana que es presenta com a vicepresidenta). La seqüència a la que més s'assembla el nom de "SARAHPALIN" és una proteïna del fong Botryotinia fuckeliana (Només cal que traduïu la paraula anglesa fuck per entendre la gràcia). Podeu llegir la història en el següent blog.

4 comentaris:

Pere ha dit...

Molt bo el post Vallvé! Ara que ja has fet la introducció i alguns exemples, suposo que tothom podrà llegir el missatge ocult a la capçalera de el llindar.

Lo que has trobat de la Palin al blog de l'Esien és boníssim! :D I els comentaris encara més...

Pere ha dit...

Per cert, no hi ha ni un link al OPTIMIZER! Homeeee!

Vallve ha dit...

Home pere, hi ha un link al teu post sobre el tema i una referència explícita al blog del llindar. Em sembla que no et pots queixar.

Asimetrich ha dit...

Què bo ho de la Pahlin jejeje. Ja tenen un altre cosa de la que preocupar-se els polítics a l'hora de dissenyar les campanyes.