divendres, 18 de desembre de 2009

Tanquem l'any Darwin amb regals ....

Per acabar l'any Darwin algunes idees per fer un regal "evolutiu". N'hi ha per totes les edats i gustos. Bé, per tots els gustos (creacionistes o IDiots) potser no. Extret de l'"Evolver Zone", a resource for students, teachers, and researchers with an interest in evolution.





















dissabte, 12 de desembre de 2009

Gadgets sobre Bioinformatica

Aquí van una serie de Gadgets sobre Bioinformàtica molt útils desenvolupats per Your Lab Data.


DNA to Protein

Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.



Sequence Manipulation

The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.

Protein to DNA

Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.


Palindromic sequences finder

Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences.

Restriction digest of DNA

Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).

Sequence:
Show code
Min. recognition size for each enzyme
Type of restriction enzyme
Use only this endonuclease

Only use enzymes with known bases (no N,R,Y...)
Include Type IIb restriction enzymes
Include Type IIs restriction enzymes
When two or more input sequences are searched:
Show only endonucleases showing different restriction patterns for searched sequences.

Reverse Complement Gadget


Reverse Complement - Bioinformatics Tools



Description:"Reverse Complement - Bioinformatics Tools" Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.
Author: Your Lab Data

Melting Temperature (Tm) calculator

This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.



Microsatellite Repeats Finder

This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.


In Silico PCR Amplification

In Silico PCR Amplification




Description: Simulation of PCR amplification. Allows one mismatch between primer and template.
Author: Your Lab Data

Primer3 (Basic Edition)

Primer3 (Basic Edition)




Description:Primer3 is a widely used program for designing PCR primers (PCR = 'Polymerase Chain Reaction'). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.
Author: Your Lab Data

dijous, 3 de desembre de 2009

Els Bioquímics també la saben tocar ....

En José González és un bioquímic Suec, fill de pares argentins. És famós però per les seves cançons. Acompanyat d'una guitarra clàssica té un estil que alguns anomenen com Indie folk. Declara que el seu artista favorit és en Sílvio Rodríguez. Va publicar el seu primer disc al 2003 (que es va editar als EEUU i UK al 2005) mentre feia el doctorat en Bioquímica a la Universitat de Gothenburg. L'èxit musical però el va fer deixar els estudis de tercer cicle per dedicar-se al món de la música. El segon disc, titulat In our nature, el va presentar al Setembre del 2007. Ha declarat que algunes de les lletres d'aquest disc van ser influenciades per la lectura del llibre "El espejismo de Dios" (The God Delusion, 2006) d'en Richard Dawkins. Algunes de les seves cançons o versions han estat utilitzades en diferents episodis d'algunes de les sèries de més èxit com Bones o Brothers & Sisters i en algun anunci. La seva versió de la cançó "Massive Attack" va ser utilitzada en un episodi de la quarta temporada de la sèrie House (Massive Attack és la cançó utilitzada com a sintonia principal en aquesta sèrie).

Aquí van alguns vídeos seus:







Aquest post inaugura la secció de Bioquímics il·lustres, encara que el primer bioquímic il·lustre del que hem parlat en aquest blog ha estat en Craig Venter.

dijous, 26 de novembre de 2009

Tests genetics i Genealogies

Des de fa uns anys ençà han sorgit tot una sèrie d'empreses relacionades amb el món dels tests genètics. L'usuari els hi envïa una mostra del seu DNA, l'empresa l'analitza i et ven els resultats. Un tipus d'aquestes empreses et venen "anàlisis d'origen", per exemple:
Un test .... le permitirá investigar su origen mediante una simple muestra de saliva. Se determinarán su haplogrupo, su pueblo originario y su región de origen. Dependiendo de su perfil genético, una categorización en un solo pueblo antiguo no es posible. Al ser este el caso, recibirá una lista con cada pueblo antiguo posible. El test incluye un acceso sin restricción de tiempo al mayor banco de datos de genealogía ADN en el mundo. Allí puede encontrar familiares que hasta el momento le eran desconocidos.

Un del tests de la companyia iGenea t'ofereixen descobrir si ets descendent de Napoleò:
La gran oportunidad de comparar los perfiles genéticos de los descendientes masculinos directos de Napoleón : compare su perfil con los de otros posibles descendientes.

iGENEA busca personas que tengan ascendencia directa por la línea masculina de Napoleón Bonaparte I. La línea directa masculina incluye a su vez los siguientes parentescos con Napoleón.

I és que es tenen dades genètiques d'alguns personatges famosos, veieu el link següent, entre d'altres:
La majoria d'aquestes dades genètiques corresponen als anomenats DNA Haplotypes, és a dir variants en una posició del genoma (coneguts amb el nom de SNPs) normalment del genoma mitocondrial o del cromosoma Y, obtinguts a partir de l'anàlisi genètic dels óssos, pèls o altres restes dels personatges. Fins i tot es comença a disposar de més informació genètica d'un sol individu. L'extrem és disposar de la seqüència complerta del genoma. Entre altres, les persones (algunes anònimes, altres amb noms i cognoms) de les quals s'ha seqüenciat el seu genoma són (veieu un llistat més extens en aquest link):

Hi ha força gent interessada en la Genealogia i la cerca dels seus ancestres. Per fer-ho, però, no calen anàlisis de DNA, només molta paciència per cercar tota la informació. Això sí, et pots trobar amb sorpreses i es que tots (en més o menys mesura) estem relacionats. Fixeu-vos per exemple en les relacions genealògiques dels presidents dels Estats Units. Com a curiositat us diré que resulta que un servidor és descendent d'un fill bastard del "Señor de Neboeyro", de contrades galleges.

dimarts, 24 de novembre de 2009

Fa 150 anys .....

El 24 de Novembre de 1859 (avui fa 150 anys) es va publicar la primera edició de l'origen de les espècies de Charles Darwin. A Internet hi han forces llocs on es fan ressò d'aquest fet. Jo us aconsello la visita als següents:

divendres, 30 d’octubre de 2009

Made with molecules

La unió d'art i ciència no està gaire explotada. Si l'altre dia veiem tatuatges amb motius científics, avui li toca el torn a les arracades, polseres i collars. Disponibles a http://www.madewithmolecules.com/:

divendres, 16 d’octubre de 2009

Com explorar l’estat de la grip a tot el món

Es pot fer un seguiment "a temps real" de l'estat de la grip a tot el món? Es pot fer a partir de la informació que el cercador google emmagatzema sobre la freqüència d'ús de certes paraules i combinacions quan els usuaris utilitzen aquest cercador?
Segons el nou servei que acaba de llançar Google, anomenat "Flu Trends":

"Ens hem adonat que certs termes de cerca són bons indicadors de la incidència de la grip. "Google Flu Trends" utilitza dades globals de la Cerca de Google per calcular la incidència actual de la grip a tot el món pràcticament en temps real.

Cada setmana, milions d'usuaris de tot el món cerquen informació relacionada amb la salut en línia. Com és d'esperar, hi ha més cerques relacionades amb la grip durant la seva temporada, més cerques relacionades amb les al·lèrgies durant la seva temporada i més cerques relacionades amb les cremades solars durant l'estiu. Podeu explorar tots aquests fenòmens amb Estadístiques de cerca de Google. Però, poden proporcionar les tendències de les consultes la base d'un model precís i fiable sobre els fenòmens del món real? Els nostres resultats s'han publicat a la revista Nature (en anglès).

Hem detectat una estreta relació amb la quantitat de persones que cerquen temes relacionats amb la grip i la quantitat de persones que presenten símptomes de grip. Per descomptat, no tothom que cerca la paraula "grip" té la malaltia, però sorgeix un patró quan totes les consultes de cerca relacionades amb la grip se sumen. Hem comparat els nostres nombres de consultes amb els sistemes tradicionals de monitoratge de la grip i hem detectat que moltes consultes de cerca tendeixen a ser populars en el moment exacte en què es produeix la temporada de la grip. En comptar la freqüència amb què veiem aquestes consultes de cerca, podem calcular quanta grip circula en diversos països i regions de tot el món. Els nostres resultats s'han publicats a la revista Nature (en anglès)."


Criteris de cerca (en anglès) utilitzats per a predir els casos de grip. En blau: Càlcul de Google. En groc: Dades reals de casos de grip a Espanya


Incidència de la grip a Espanya. En blau: Càlcul de Google. En groc: Dades reals de casos de grip a Espanya


La idea em sembla bona. L'article on es descriu és del febrer del 2009 i per tant feia referència a l'anomenada grip estacional. Aprofitant la "pandèmia" actual de la grip nova s'han decidit a possar-ho a Internet, creant el "Google Flu Trends". Però no m'imagino un pitjor moment per a fer-ho. Resulta que ara les cerques a Internet sobre la grip segur que han augmentat però degut a l'alarma social i no per un augment del nombre de casos.

Altres recursos sobre la grip:

dissabte, 10 d’octubre de 2009

El joc dels disbarats

Qui no ha jugat de petit al joc dels disbarats? En rotllana cada un fa una pregunta i escolta la resposta a qui té a un costat i alhora escolta la pregunta i contesta a qui té a l'altre costat. Després es combinen les preguntes amb les respostes de l'altre costat i els disbarats estan assegurats. Una versió diària d'aquest joc es dóna quan algú li explica a una altre persona una cosa, aquest li explica a l'altre, que li explica a un altres, ..... si comparem la primera versió amb la darrera pot ser que siguin totalment diferents.

Una cosa així és el que ha passat amb la notícia del premi Nobel de Química d'aquest any, especialment la notícia que va aparèixer en les versions digitals dels diaris el mateix dia que es va fer públic els premis, el dia 7 d'octubre. (Nota: per entendre plenament aquest post calen uns coneixements mínims d'anglès i unes nocions molt bàsiques de biologia. Els periodistes doncs, no cal que continueu llegint):

El comunicat de premsa de La Reial Acadèmia Sueca de les Ciències, en la seva versió anglesa, començava d'aquesta manera:

"The Nobel Prize in Chemistry for 2009 awards studies of one of life's core processes: the ribosome's translation of DNA information into life. Ribosomes produce proteins, which in turn control the chemistry in all living organisms. As ribosomes are crucial to life, they are also a major target for new antibiotics.

This year's Nobel Prize in Chemistry awards Venkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath for having showed what the ribosome looks like and how it functions at the atomic level. All three have used a method called X-ray crystallography to map the position for each and every one of the hundreds of thousands of atoms that make up the ribosome.

Inside every cell in all organisms, there are DNA molecules. They contain the blueprints for how a human being, a plant or a bacterium, looks and functions. But the DNA molecule is passive. If there was nothing else, there would be no life."


Hi ha una versió en Suec i una versió en hebreu d'aquest comunicat de premsa, però no una versió en castellà. Encara que el text en anglès no es gaire difícil d'entendre, un es pot plantejar utilitzar un traductor automàtic per a traduir-ho al castellà. Si per exemple utilitzem un dels molts traductors que trobem en línea, el Google translate, obtindrem la següent versió:

"El Premio Nobel de Química en 2009 los estudios de los premios de uno de los procesos básicos de la vida: la traducción del ribosoma de la información del ADN en la vida. Los ribosomas producen proteínas, que a su vez, el control de la química en todos los organismos vivos. Como los ribosomas son cruciales para la vida, también son un blanco importante de nuevos antibióticos.

Nobel de este año los premios Nobel de Química Venkatraman Ramakrishnan, Thomas A. Steitz y Ada E. Yonath por haber demostrado lo que el ribosoma, como se ve y cómo funciona a nivel atómico. Los tres han usado un método llamado cristalografía de rayos X para trazar la posición de todos y cada uno de los cientos de miles de átomos que componen el ribosoma.

Dentro de cada célula en todos los organismos, hay moléculas de ADN. Contienen los planos de cómo un ser humano, una planta o una bacteria, se ve y funciona. Sin embargo, la molécula de ADN es pasiva. Si no había nada más, no habría vida."


Està clar que a un traductor automàtic no li podem demanar meravelles i la traducció es bastant deficient, més si recordes alguna cosa bàsica de biologia. Bé d'acord, qui fa servir un traductor automàtic? Seria millor anar a l'edició electrònica d'algun diari i llegir la notícia, normalment provinent d'alguna agència de notícies com l'agència EFE. La versió, provinent de l'agència EFE, que va sortir en molts diaris digitals o pàgines d'emissores de TV (per exemple el Diari de Tarragona, adn, la vozlibre, antena3noticias, cuatro) el mateix 7 d'octubre era:

"La Real Academia Sueca de las Ciencias concedió hoy el Premio Nobel de Química 2009 a tres científicos por descifrar el funcionamiento de los ribosomas, que producen las proteínas necesarias para mantener con vida el ADN.

Los científicos estadounidenses Venkatraman Ramakrishnan y Thomas A. Steitz y la israelí Ada E. Yonath lograron mostrar el aspecto y funcionamiento de los ribosomas a nivel molecular mediante un método denominado cristalografía de rayos X.

En toda célula de un organismo hay moléculas de ADN que contienen las huellas personales de cada ser vivo, bien sea humano, planta o bacteria.

La molécula de ADN, sin embargo, es pasiva y no sería nada si no fuera convertida en materia viva, proceso en el que los ribosomas desempeñan un papel crucial, pues son los responsables de crear las proteínas, las herramientas universales de la vida."


Fins i tot pitjor que el traductor automàtic .... Em pensava que l'agència EFE era una agència seriosa i que les notícies passaven alguna mena de filtre. No se què es pitjor, que no hagi passat cap filtre, o que ningú s'hagués adonat de que la notícia era bastant deficient. Bé, em podeu dir que he anat a fixar-me en el pitjor, que podria buscar una font de notícies més seriosa com el canal 3/24. Doncs la versió que va aparèixer al teletext i a la web va ser:

"Nobel de Química per als pioners de la genètica per al desenvolupament de nous antibiòtics.

Els científics nord-americans Venkatraman Ramakrishnan i Thomas A. Steitz i la israeliana Ada E. Yonath han guanyat el Nobel de Química 2009 pels seus estudis sobre l'estructura i la funció del ribosoma, que produeix les proteïnes necessàries per mantenir amb vida l'ADN. Es tracta dels pioners de la genètica per al desenvolupament de nous antibiòtics. L'Acadèmia Sueca lliurarà el premi el proper 10 de desembre, en l'aniversari de la mort del seu fundador, Alfred Nobel."


Aquesta versió és en part, una versió traduïda al català de la versió de l'agència EFE, però hi apareixen nous elements: "la genètica" Suposo que està de moda parlar de genètica i la notícia tindrà més impacte si fem servir la paraula en algun lloc, oi?

dimecres, 7 d’octubre de 2009

Premi Nobel de (Bio)Química 2009

La Reial Acadèmia Sueca de les Ciències ha anunciat avui la concessió del Premi Nobel de Química 2009 als científics nordamericans Venkatraman Ramakrishnan (del MRC Laboratory of Molecular Biology, Cambridge, UK), Thomas A. Steitz (del Howard Hughes Medical Institute, Yale University) i la científica israeliana Ada E. Yonath (del Weizmann Institute of Science, Israel) pels "seus estudis sobre l'estructura i funció dels ribosomes". Els ribosomes (orgànuls formats per una part proteica i RNA ribosòmic, on té lloc la traducció) són peces essencials per a la vida ja que en ells té lloc la síntesi de proteïnes. Els ribosomes, doncs, els trobem en tots els éssers vius. Hi ha però algunes diferències, especialment de mida, entre els ribosomes dels bacteris i els de les cèl·lules eucariotes. Són precisament aquestes diferències les que han permès dissenyar antibiòtics que inhibeixen selectivament la funció dels ribosomes dels bacteris. I és que inhibir la funció dels ribosomes representa la mort per a les cèl·lules.

Les investigacions sobre l'estructura dels ribosomes es van iniciar fa més de 30 anys i van culminar l'any 2000 amb la determinació, per part dels equips de recerca dels tres guardonats, de l'estructura tridimensional de les dues subunitats que formen els ribosomes. En concret, l'equip dirigit pel Dr Steitz va determinar l'estructura tridimensional de la subunitat gran del bacteri Haloarcula marismortui, i els equips dels Dr Yonath i Ramakrishnan van determinar, de forma independent, l'estructura de la subunitat petita del bateri Thermus thermophilus. Determinar l'estructura tridimensional d'una proteïna significa conèixer la posició tridimensional de tots els àtoms que la formen, i encara que no és tasca senzilla, en l'actualitat es coneixen les estructures de milers de proteïnes.

En el cas de l'estructura tridimensional del ribosoma, es valora la gran complexitat que suposa l'obtenció de cristalls (pas previ a la difracció de raigs X i a la determinació de l'estructura) i la determinació estructural d'un complex format per desenes de subunitats proteiques i subunitats formades per RNA ribosòmic. Aquesta part formada per RNA participa també directament en el mecanisme catalític i per això els ribosomes sovint es posen com a exemple quan es parla dels ribozims (cadena de RNA que té activitat catalítica).

Disposar de l'estructura tridimensional dels ribosomes ha permès descobrir els detalls moleculars de la interacció de certs antibiòtics amb els ribosomes i ha proporcionat noves eines per al disseny de nous antibiòtics, alguns d'ells ja en fase d'experimentació, per guanyar així la batalla contra la resistència bacteriana a aquests fàrmacs.

A part de la notícia, durant el procés de cerca d'informació sobre la notícia, m'he fet les següents reflexions:
  • Fixeu-vos la importància que va adquirint la recerca en Biociències (i en Bioquímica) en l'actualitat. Ja van tota una sèrie de premis Nobel de Química relacionats amb aquests temes (per exemple el de l'any passat i el d'aquest). Haurien de canviar de nom i anomenar-se Premis Nobel de Bioquímica? Veieu també els Premis Nobel de Fisiologia i Medecina.

  • El mal redactat que alguns mitjans de comunicació i pàgines web fan de la notícia. I és que no n'encerten ni una, barregen les coses, exageren desmesuradament el descobriment, o es centren en aspectes secundaris. Aquest punt ja el desenvoluparé amb més detall en un post posterior.

  • L'embolic que es fan alguns amb les nacionalitats: "Los científicos estadounidenses Venkatraman Ramakrishnan y Thomas A. Steitz y la israelí Ada E. Yonath ....", "El indio Venkatraman Ramakrishkan, el estadounidense Thomas A. Steiltz y la israelí Ada Yonath ...." i "El británico Venkatraman Ramakrishnan, el estadounidense Thomas Steitz y la israelí Ada Yonath ...." Tres versions diferents sobre la nacionalitat del Dr Venkatraman Ramakrishnan que va néixer a l'Índia, és ciutadà americà però actualment treballa a Gran Bretanya ....

  • Sempre es diu que els premis Nobel es donen després d'uns 20 anys o més del descobriment/s, investigacions o publicació pels quals són mereixedors dels premis. S'assegura així que els premis es donin a descobriments que hagin tingut una gran repercussió en la societat, recerca, salut, .... Els articles que descriuen les estructures tridimensonals dels ribosomes són de l'any 2000. Només 9 anys, un període curt si el comparem amb altres premis Nobel.

  • L'anterior punt en porta a pensar que potser el premi Nobel per la seqüenciació del genoma humà (2001) caurà aviat

  • Finalment em suggereixen que un post seriós sobre aquest tema hauria d'incloure la informació de quin dia es donen els premis Nobel i la quantia del premi. Doncs els premis es donaran el 10 de Desembre i el premi (en aquest cas a repartir en tres terceres parts) és de 10 milions de corones Sueques.....

dilluns, 5 d’octubre de 2009

Edició il·lustrada de l'origen de les espècies en Català

Per fi tinc entre les mans una nova edició en català i il·lustrada de l'"origen de les espècies" de Charles Darwin. Es tracta d'un llibre de gran format per la seva mida però també per la seva curada edició. No estem davant d'una reedició d'una traducció ja existent, si no que es tracta d'una traducció feta pels investigadors de la Universitat de València Juli Peretò i Andrés Moya de la primera edició. Tal i com els autors esmenten en el pròleg "Hi ha una opinió general que, de les sis que es publicaren al llarg de quasi vint anys, la primera edició de L'origen és la més vívida i audaç, la que presenta el pensament de Darwin d'una manera més original i directa, sense la càrrega afegida de les respostes a la pluja de crítiques rebudes, moltes de les quals, vistes d'avui, tenen un escàs valor i interès.". Com a curiositat podeu veure totes les modificacions que Darwin va fer al llarg de les sis edicions de l'obra a l'adreça http://benfry.com/traces/.

Aquesta nova versió catalana ha estat però "alleugerida", així s'han escurçat la diversitat d'exemples de l'obra original i s'ha suprimit el capítol on es parla de l'herència, "atès que la informació de la qual disposava l'autor és actualment poc o gens rellevant i té, per tant, un interès purament històric.". M'ha fet gràcia també el fet que com diuen els autors "En alguna part del llibre, que no revelarem, hem deixat anar algun anacronisme: hem emprat el text de Darwin amb exemples contemporanis, només per reforçar la seua condició de clàssic, de plena vigència de les propostes originals." A veure si trobem aquests anacronismes ...

Un altre fet molt destacable de l'obra és que es tracta d'una edició il·lustrada. El llibre conté unes dues-centes il·lustracions fetes per en Carles Puche, moltes d'elles exemplificant les variacions entre espècies molt relacionades d'animals o de plantes o mostrant alguna de les idees que Darwin ens volia transmetre a través del text. I és que de fet, en les sis edicions originals de l'"origen de les espècies", només hi apareix una única figura, la que en aquesta edició catalana apareix en la pàgina 50 i que correspon a un esquema de la divergència de les espècies.

M'ha fet gràcia també la figura de la última plana, provinent d'un dels quaderns de notes de Darwin del 1837, de "l'arbre de la vida de Darwin". Una de les primeres representacions de l'anomenat arbre de la vida o "tree of life".

En resum, un llibre molt recomanable, ideal per fer un regal. Per cert jo ja el tinc, us haureu de pensar un altre ....

dilluns, 28 de setembre de 2009

Manifiesto sobre la Financiación de la Ciencia en España

Aquests dies els mitjans de comunicació es fan un tip de parlar sobre els pressupostos de l'any vinent que han de ser aprovats al congrés durant el mes d'octubre. Es destaquen principalment dues coses: les crítiques de quasi tots els partits polítics per la pujada dels impostos i la mala gestió de la crisis econòmica. Ningú no fa esment però d'un altre fet molt rellevant per al futur de la Ciència en aquest país, i és que les primeres dades sobre la inversió del govern en I+D per l'any vinent es parlava de que es reduiria més d'un 30%. Això venien a ser uns 580 mil·lions d'euros, el preu d'uns sis 'ronaldos'. Veieu l'article "¿Hundir la ciencia por el precio de seis 'ronaldos'?" Al final sembla que la retallada no serà tan gran, però continua sent una molt mala notícia pel futur científic d'aquest país. Ja s'han sentit algunes reaccions a través d'alguna carta als diaris, blogs i també a través de la Sociedad Española de Bioquímica y Biología Molecular que ha elaborat un breu manifest. Aquest blog s'afegeix a aquest manifest, feu-lo córrer.



Oviedo, 24 de Septiembre de 2009

El presidente y los ex presidentes de la Sociedad Española de Bioquímica y Biología Molecular, con ocasión del 32 Congreso Nacional de Bioquímica y Biología Molecular,

MANIFIESTAN:
  • Que deben mantenerse las dotaciones presupuestarias destinadas a la investigación científica básica y, en particular, al Plan Nacional y a los programas de investigación en red.

  • Que el Plan de Economía Sostenible del Gobierno no puede llevarse a efecto con éxito sin contar con una sólida base científica.

  • Que la inversión en I+D es esencial para consolidar, tanto en España, como en Europa, una economía basada en el conocimiento, según lo acordado en la cumbre europea de Lisboa del año 2000.


Firman:

Miguel Ángel de la Rosa Acosta
Federico Mayor Zaragoza
Margarita Salas Falgueras
Carlos Gancedo Rodríguez
Joan J. Guinovart Cirera
Jesús Ávila de Grado
Vicente Rubio Zamora

divendres, 25 de setembre de 2009

Ingredients per elaborar una bona cervesa

Quins són els ingredients per fer una bona cervesa? Bàsicament quatre: Malta, aigua, llúpol i llevat. De fet en certs països com Alemanya, per llei la cervesa només pot estar formada per aquests quatre ingredients. Anem per parts:
  • Malta: La malta no es res més que l'ordi (barley en anglès o cebada en castellà) germinat. El primer pas del procés d'elaboració de la cervesa, anomenat Maltatge o malting té com a objectiu transformar l'ordi, germinant-lo en malta. En aquest procés es sintetitzen els enzims (amilases, cel·lulases i proteases principalment del propi ordi, amb l'objectiu de que la llavor creixi per regenerar una nova planta) per a transformar el midó en glucosa i maltosa. En aquest procés cal controlar molt bé la Temperatura i humitat. Obtenir una bona cervesa depèn en bona part de la qualitat de l'ordi i malta obtinguts.

  • Aigua: No calen més observacions sobre aquest ingredient, oi? Un cop l'ordi ha germinat es molt i s'afegeix aigua. L'objectiu és degradar el midó en sucres fermentables (glucosa i maltosa principalment) és a dir fer una sacarificació. La producció de proteases i cel·lulases i el fet de moldre la malta ajudaran a que les amilases accedeixin més fàcilment al midó. Les proteases també ens serviran per treure la terbolesa i són importants en l'estabilitat i formació de l'escuma del producte final. Cal destacar que l'aigua participa directament en el mecanisme de reacció dels enzims de la classe de les hidrolases (amilases, cel·lulase i proteases entre altres).

  • Llúpol (lúpulo en castellà o hop en anglès): És un producte vegetal que es va introduir l'any 1133 per conservar millor el producte final. Això és pels seus efectes bactericides. Avui en dia no caldria afegir-ho per aquest motiu, però resulta que és l'ingredient que li dóna el característic gust amarg a la cervesa, així doncs el gust d'una cervesa sense llúpol ja no ens semblaria cervesa. S'afegeix en el procés de cocció del most o boiling. El temps i T de la cocció influiran en el producte final. La cervesa negra està més "torrada" que la rosa.

  • Llevat: Microorganisme encarregat de transformar la glucosa i altres sucres fermentables originats en la hidròlisis del midó de l'ordi en etanol i CO2. Aquest procés conegut com fermentació alcohòlica té lloc en condicions anaeròbiques (absència d'oxigen) i té lloc en els anomenats fermentadors. Bàsicament s'utilitzen dues espècies de llevat: Saccharomyces cerevisiae (el mateix llevat utilitzat en l'elaboració del vi, elaboració del pa, ....) i Saccharomyces carlsbergensis. El llevat no pot utilitzar el midó, doncs li manquen els enzims necessaris per la seva hidròlisi. Així doncs, les primeres etapes de l'elaboració de la cervesa es centren en obtenir a partir del midó, glucosa i altres sucres fermentables. Com a curiositat, el CO2 obtingut durant la fermentació es recull i s'afegeix més tard, en el procés anomenat carbonatació.


Tot i que la cervesa es pot elaborar sense l'adició de cap enzim extern això no vol dir que no intervinguin enzims en la seva elaboració. Els enzims es trobem en les matèries primeres (ordi, llevats que afegim per fer la fermentació) i s'hauran de controlar les condicions perquè actuïn correctament. En la producció industrial de cervesa, però, cada cop s'utilitzen més enzims "externs" que afegim entre altres coses per poder utilitzar altres matèries primeres, estalviar costos, millorar el procés d'elaboració i el que és més important, perquè el producte final tingui sempre les mateixes característiques. Els enzims "externs" que es poden afegir són amilases, amiloglucosidases, cel·lulases, beta-glucanases i proteases en les fases de la maceració i abans i després de la fermentació per tal de millorar la degradació del midó, reduir la terbolesa, augmentar els rendiments o facilitar els filtratges.

Hi pot haver però altres ingredients per elaborar cervesa? Només cal que ens fixem en les etiquetes d'algunes de les cerveses més populars. Per exemple:
  • Budweiser: Si ens fixem en els ingredients que figuren en l'etiqueta d'aquesta cervesa hi podrem llegir: "Brewed by our original all natural process using the Choicest Hops, Rice and Best Barley Malt", una cosa com Elaborada fent servir un procés original i natural fent servir Llúpols seleccionats, Arròs i la millor Malta d'ordi. Arròs? Sí. Una possibilitat en la elaboració de la cervesa és afegir juntament amb la Malta, altres tipus de cereal o arròs. Així es dóna a la cervesa un toc diferent. Segons la web de Budweiser: "We brew our lager using fresh, verdant rice -milled, polished, graded and immediately brewed -never stored- to give Budweiser its light, crisp and refreshing taste"

  • Fosters: Si ens fixem en els ingredients que figuren en l'etiqueta d'aquesta cervesa australiana hi trobarem: "Agua, Cebada Malteada, Jarabe de Glucosa, Lúpulo" Xarop de Glucosa? Sí, normalment obtingut també a partir de la hidròlisis enzimàtica del midó de l'ordi. L'objectiu de les primeres etapes de l'elaboració de la cervesa és l'obtenció de sucres fermentables a partir del midó, per què no afegir directament glucosa per a que els llevats la transformin en etanol? M'imagino que així s'estalvien ordi i bona part de les etapes del seu processat. El gust d'aquesta cervesa és molt menys intens que les altres. De totes maneres la cervesa no és només etanol i CO2. Fixeu-vos que en cap cas es substitueix tot l'ordi per xarop de glucosa i és que en l'ordi també hi trobem altres substàncies que trobem en el producte final.

  • Una altra possibilitat és afegir ordi o altres cereals sense germinar després del maltatge. Així podem augmentar la producció perquè part de l'ordi no cal que germini o podem obtenir cerveses amb característiques finals diferents. Si es fa això és important afegir els enzims (amilases, proteases, cel·lulases) per fer la maceració correctament. En últim extrem es podria partir directament de l'ordi sense germinar si afegim els enzims necessaris per degradar el midó. Recentment l'empresa Novozymes acaba de comercialitzar un enzim o còctel d'enzims per fer precisament això: cervesa a partir d'ordi sense germinar, i ja hi ha una empresa que comercialitzarà aquesta cervesa. Ja veurem quina és la seva qualitat.


En relació al procés d'elaboració de la cervesa, fa un temps us vaig parlar de les cerveses light, per tant no cal afegir res més sobre aquest tema.

Finalment us deixo el vídeo del programa Quèquicom va dedicar a la cervesa: