dimarts, 30 de desembre de 2008

Nou equip Assessor d'Obama sobre ciencia

El President Obama fa just uns dies que ha anunciat el seu nou equip que l'haurà d'assessorar sobre qüestions científiques. Aquí us deixo un vídeo del seu discurs, així com el text original i una traducció que m'he permès fer amb l'ajuda d'alguns traductors automàtics. Com a declaració d'intencions sobre el paper de la ciència en la nova Administració no està gens malamens. Esperem que sigui realment així.





Remarks of the President-Elect Barack Obama
Science Team Rollout Radio Address
Friday, December 17, 2008
Chicago, Illinois

Over the past few weeks, Vice President-Elect Biden and I have announced some of the leaders who will advise us as we seek to meet America’s twenty-first century challenges, from strengthening our security, to rebuilding our economy, to preserving our planet for our children and grandchildren. Today, I am pleased to announce members of my science and technology team whose work will be critical to these efforts.

Whether it’s the science to slow global warming; the technology to protect our troops and confront bioterror and weapons of mass destruction; the research to find life-saving cures; or the innovations to remake our industries and create twenty-first century jobs—today, more than ever before, science holds the key to our survival as a planet and our security and prosperity as a nation. It is time we once again put science at the top of our agenda and worked to restore America’s place as the world leader in science and technology.

Right now, in labs, classrooms and companies across America, our leading minds are hard at work chasing the next big idea, on the cusp of breakthroughs that could revolutionize our lives. But history tells us that they cannot do it alone. From landing on the moon, to sequencing the human genome, to inventing the Internet, America has been the first to cross that new frontier because we had leaders who paved the way: leaders like President Kennedy, who inspired us to push the boundaries of the known world and achieve the impossible; leaders who not only invested in our scientists, but who respected the integrity of the scientific process.

Because the truth is that promoting science isn’t just about providing resources—it’s about protecting free and open inquiry. It’s about ensuring that facts and evidence are never twisted or obscured by politics or ideology. It’s about listening to what our scientists have to say, even when it’s inconvenient—especially when it’s inconvenient. Because the highest purpose of science is the search for knowledge, truth and a greater understanding of the world around us. That will be my goal as President of the United States—and I could not have a better team to guide me in this work.

Dr. John Holdren has agreed to serve as Assistant to the President for Science and Technology and Director of the White House Office of Science and Technology Policy. John is a professor and Director of the Program on Science, Technology, and Public Policy at Harvard’s Kennedy School of Government, as well as President and Director of the Woods Hole Research Center. A physicist renowned for his work on climate and energy, he’s received numerous honors and awards for his contributions and has been one of the most passionate and persistent voices of our time about the growing threat of climate change. I look forward to his wise counsel in the years ahead.

John will also serve as a Co-Chair of the President’s Council of Advisors on Science and Technology—or PCAST—as will Dr. Harold Varmus and Dr. Eric Lander. Together, they will work to remake PCAST into a vigorous external advisory council that will shape my thinking on the scientific aspects of my policy priorities.

Dr. Varmus is no stranger to this work. He is not just a path-breaking scientist, having won a Nobel Prize for his research on the causes of cancer—he also served as Director of the National Institutes of Health during the Clinton Administration. I am grateful he has answered the call to serve once again.

Dr. Eric Lander is the Founding Director of the Broad Institute at MIT and Harvard and was one of the driving forces behind mapping the human genome—one of the greatest scientific achievements in history. I know he will be a powerful voice in my Administration as we seek to find the causes and cures of our most devastating diseases.

Finally, Dr. Jane Lubchenco has accepted my nomination as the Administrator of NOAA, the National Oceanic and Atmospheric Administration, which is devoted to conserving our marine and coastal resources and monitoring our weather. An internationally known environmental scientist and ecologist and former President of the American Association for the Advancement of Science, Jane has advised the President and Congress on scientific matters, and I am confident she will provide passionate and dedicated leadership at NOAA.

Working with these leaders, we will seek to draw on the power of science to both meet our challenges across the globe and revitalize our economy here at home. And I’ll be speaking more after the New Year about how my Administration will engage leaders in the technology community and harness technology and innovation to create jobs, enhance America’s competitiveness and advance our national priorities.

I am confident that if we recommit ourselves to discovery; if we support science education to create the next generation of scientists and engineers right here in America; if we have the vision to believe and invest in things unseen, then we can lead the world into a new future of peace and prosperity.

Thank you.
Comentaris del President Electe Barack Obama
Adreçat a la Ràdio sobre l'Equip de Ciència

Divendres, 17 de desembre, de 2008
Chicago, Illinois

Durant les passades setmanes, el Vice President electe Biden i jo hem anunciat alguns dels líders que ens han d'assessorar en la recerca de satisfer els reptes d'Amèrica del segle XXI i que ens han de portar a l'enfortiment de la nostra seguretat, la reconstrucció de la nostra economia, i a la preservació del nostre planeta per als nostres fills i néts. Avui, em plau anunciar els membres del meu equip de ciència i tecnologia la tasca del qual serà fonamental per aquests esforços.

Ja sigui en la ciència per alentir l'escalfament global, la tecnologia per protegir a les nostres tropes i fer front al bioterrorisme i les armes de destrucció massiva, la recerca per trobar cures que estalviïn vides, o les innovacions per refer les nostres indústries i per crear avui els llocs de treball del segle XXI, més que mai, la ciència és la clau per a la nostra supervivència com a planeta i la nostra seguretat i prosperitat com a nació. Ja és hora que, una vegada més, posem la ciència en les prioritats del nostre programa i treballem per restaurar el lloc dels Estats Units com a líder mundial en la ciència i tecnologia.

Ara mateix, en laboratoris, aules i empreses de tota Amèrica, les nostres principals ments estan treballant fort empaitant la propera gran idea, en la cúspide dels avenços que podrien revolucionar les nostres vides. Tanmateix, la història ens diu que no poden fer-ho sols. Des de l'aterrarratge a la lluna, fins a la seqüènciació del genoma humà, o la invenció d'Internet, els Estats Units han estat els primers en creuar la nova frontera, ja que hen tingut dirigents que han aplanat el camí: dirigents com el President Kennedy, que ens va inspirar per prémer els límits del món conegut i aconseguir l'impossible; dirigents que no solament invertien en els nostres científics, sinó que respectaven la integritat del procés científic.

Perquè la veritat és que la promoció de la ciència no és només proporcionar els recursos- es tracta de protegir la recerca lliure i oberta. Es tracta de garantir que els fets i les evidències no siguin enfosquits per la política o la ideologia. Es tracta d'escoltar el que els nostres científics han de dir, fins i tot quan no ens agrada, especialment quan no ens agrada. Degut a que el més alt propòsit de la ciència és la recerca del coneixement, la veritat i una comprensió més gran del món que ens envolta. Aquest serà el meu objectiu com a President dels Estats Units- i no podria tenir un millor equip per guiar-me en aquesta tasca.

El Dr. John Holdren ha acceptat servir com a Ajudant del President per a la Ciència i Tecnologia i Director de la oficina de Política de Ciència i Tecnologia de la Casa Blanca. John és professor i el Director del Programa sobre Ciència, Tecnologia, i Política Pública a la Harvard Kennedy School of Goverment, així com President i Director del Woods Hole Reserach Center. Un físic de renom pel seu treball sobre el clima i l'energia, que ha rebut nombrosos honors i premis per les seves contribucions i ha estat una de les més apassionades i persistents veus del nostre temps sobre la creixent amenaça del canvi climàtic. Espero amb interès els seus asenyats consells en els propers anys.

John també servirà com a Co-president del Consell d' Assessors de Ciència i Tecnologia o PCAST - igual que el Dr. Harold Varmus i el Dr. Eric Lander. Junts, treballaran per fer del PCAST un consell consultiu extern vigorós que formarà la meva manera de pensar sobre els aspectes científics de les meves prioritats polítiques.

El Dr. Varmus no és estrany a aquest treball. Ell no és només un científic pioner, després d'haver guanyat un Premi Nobel per les seves investigacions sobre les causes del càncer- també ha servit com a Director dels Instituts Nacionals de Salut durant l'Administració Clinton. Estic agraït que hagi respost a la crida a servir una vegada més.

El Dr. Eric Lander és el Director fundador del Broad Institute al MIT i Harvard i va ser una de les forces impulsores darrere de la seqüènciació dels genoma humà- un dels majors èxits científics de la història. Sé que serà una veu poderosa en la meva Administració quan tractem de trobar les causes i les cures de les nostres malalties més devastadores.

Finalment, la Dra. Jane Lubchenco ha acceptat el meu nomenament com Administradora de la NOAA, l'Administració Oceànica i Atmosfèrica Nacional, que es dedica a la conservació dels nostres recursos marins i costaners i es seguiment del nostre temps. Un científic mediambiental internacionalment conegut i ecòleg i anterior President de l'Associació Americana per a l'Avenç de la Ciència, Jane ha aconsellat al President i Congrés sobre matèries científiques, i estic segur que proporcionarà lideratge vehement i dedicació a la NOAA.

Treballant amb aquests dirigents, procurarem aprofitar el potencial de la ciència tant per a complir amb els nostres reptes com revitalitzar la nostra economia aquí a casa. Parlaré més després de l'Any Nou sobre com la meva Administració comprometrà als líders de la comunitat tecnològica i d'innovació per crear llocs de treball, millorar la competitivitat d'Amèrica i promoure les nostres prioritats nacionals.

Estic convençut que si volem renovar el nostre compromís amb el descobriment, si recolzem l'ensenyament de la ciència per a crear la propera generació de científics i enginyers aquí a Amèrica; si tenim la visió per creure i invertir en coses no tangibles, llavors podem portar al món a un futur nou de pau i prosperitat.

Gràcies.

dilluns, 22 de desembre de 2008

Gens amb noms curiosos

Posar noms als descobriments científics no sempre és fàcil. En el cas de la genètica, quan s’identifica un nou gen cal posar-li un nom. El nom ha de ser breu i per això tot sovint es fan servir acrònims. Hi ha diverses possibilitats per batejar un gen:


Hi ha qui tria un nom que expressi la funció (si es coneix) de la proteïna que codifica aquest gen, o un acrònim (com el gen EYS, acrònim en anglès de l'expressió "ulls tancats", involucrat en alguns dels casos de ceguera hereditària) o un codi numèric (si per exemple els gens provenen d’un projecte de seqüènciació d’un genoma complet). I és que això de batejar els gens no és gens fàcil i és més important del que sembla. Cal que a un gen se l’anomeni sempre de la mateixa manera (fins i tot en diferents espècies) per evitar confusions. I és que normalment el primer nom amb el que es bateja a un gen, té moltes probabilitats de que s’imposi. Hi ha qui a més, busca un nom divertit, o sense voler-ho, genera un nom que fa riure. Alguns noms curiosos o divertits que podem trobar de gens o mutacions són:
  • ken i barbie: De l'espècie Drosophila melanogaster. Anomenats així perquè els seus mutants els hi manquen els genitals externs, com als ninos ken i barbie
  • superman: De l'espècie Arabidopsis thaliana. Alguns mutants d'aquest gen tenen més estams en les flors. La mutació anomenada kryptonita suprimeix l'efecte del gen superman
  • Tequila: Un gen de la mosca Drosophila melanogaster que quan està mutat evita la formació de la memòria a llarg termini
  • pokemon
  • tango
  • merlin
  • Sonic Hedgehog
  • aladin (ALacrima-achalasia-ADrenal Insufficiency Neurologic disorder)
  • Pavarotti
  • ZZZ1

És habitual però que un gen tingui més d'un nom i que gens diferents tinguin el mateix nom o acrònim. Per tot això cal posar ordre. Hi han hagut casos de noms que han estat considerats ofensius i que han estat retirats o s’han mantingut els acrònims però s’ha canviat el seu nom. En alguns casos s’ha creat un grup d’experts per posar nom als gens. És el cas de l’HUGO Gene Nomenclature Committee que té com objectiu anomenar tots els gens humans d'una forma única i amb un nom que tingui un significat.

Una base de dades divertida s'anomena "Clever Gene names" i té com a objectiu recollir noms divertits de gens. Hi ha diverses categories com art, literatura, religió, sports, cultura popular, tràfic, ... amb diversos noms reals de gens per a cada categoria. Així si trobeu un nom d'un gen divertit, ho podeu compartir amb la resta de la comunitat.


El problema amb els noms dels gens no acaba aquí. Està descrit que alguns noms de gens (com el gen DEC1, NOV2, 2310009E13, ..., ) poden generar errors en el programa Microsoft Excel, doncs el programa els interpreta com una data o com un nombre i els canvia automàticament. Per tant si mai heu d'anomenar algun descobriment científic, penseu molt bé el nom ...

divendres, 5 de desembre de 2008

Craig Venter: un ferm candidat al Nobel


Diuen que rectificar és de savis. Doncs bé, la meva opinió sobre el Dr J. Craig Venter ha canviat radicalment. La veritat és que fins ara, sense cap motiu concret, no era sant de la meva devoció. En una visió molt simplificada sobre la cursa/competició que va portar a principis del 2000 a la seqüenciació del genoma humà, el Dr Venter sempre ha estat el dolent de la pel·lícula. Ell representava una empresa comercial que volia fer diners (com totes les empreses), s'aprofitava de les dades del consorci públic i a més no feia públiques les seves dades. També en una visió molt idíl·lica de la realitat el consorci públic representava l'avenç de la ciència amb diners públics, l'altruisme i el fet de que tothom es pogués beneficiar dels avenços genòmics.

Què m'ha fet canviar d'opinió? Doncs la lectura del llibre del mateix Craig Venter "La vida descodificada". El llibre ve a ser unes memòries on explica tota la seva trajectòria humana i científica fins a l'actualitat, incloent informació sobre el seu genoma (un dels primers genomes humans que es va seqüenciar completament). I la veritat, els científics del consorci públic no queden gaire ben retratats. Segurament la veritat deu ser a mig camí del que diuen uns i el que diuen els altres. Respecte al llibre, la veritat és que si aconseguiu no abandonar-lo durant els primers capítols (on explica el principi de la seva vida i la seva experiència al Vietnam), que francament sobren, després s'anima amb la descripció de la ciència (però també sobre qüestions polítiques, comercials, ètiques, de relacions entre les persones, ...) que va viure com a protagonista. Sorprèn que al llarg del llibre, l'autor, va donant detalls del seu propi genoma, descrivint quines són les variants genètiques associades a la predisposició a patir alguna malaltia i quines variants té el seu propi genoma.

Ningú posa en dubte la contribució del Dr Venter en la seqüenciació del genoma humà (va rebre conjuntament amb altres investigadors de les dues parts, Celera i el consorci públic, el Premi Príncep d'Astúries de "Investigación Científica y Técnica" 2001), però sempre ha estat vist com el "noi dolent de la Biologia Molecular". Fixeu-vos si ha canviat la meva opinió sobre en Craig (ja no cal que el continuem anomenant tota l'estona Dr) que m'he fet del seu grup de fans del facebook ... i ja faig com els de l'editorial Espasa (editorial que ven la versió castellana del seu llibre) i considero ja al Dr Craig Venter com a guanyador del Premi Nobel, sense ser-ho (veieu el següent enllaç). De fet, les contribucions del Dr Craig Venter, que per cert és bioquímic, a la ciència són moltes i és que podem dir que sempre ha estat un innovador en tot el que ha fet. Algunes de les seves contribucions més importants són:
  • Desenvolupament dels ESTs, una estratègia per seqüènciar fragments de mRNA i que permet "caçar" els gens que s'expressen.
  • Va liderar el grup que va seqüenciar completament el primer genoma d'un organisme viu (sense contar els virus). En concret va seqüenciar el genoma del bacteri Haemophilus influenzae, al que van seguir els genomes de molts més microorganismes.
  • Va liderar el grup que va seqüenciar el genoma de la mosca de la fruita Drosophila melanogaster. Ho va fer com a banc de proves per a demostrar que l'estratègia de l'escopeta genòmica (que ja havia desenvolupat per seqüenciar els genomes bacterians) funciona en genomes més grans.
  • Va liderar el grup de l'empresa Celera genomics que va seqüenciar el genoma humà, utilitzant l'estratègia de l'escopeta genòmica.
  • Va ser l'iniciador dels projectes metagenòmics (consistents en aïllar i seqüenciar de forma global el DNA de diferents organismes que formen una comunitat). Així va agafar el seu veler, el Sorcerer II, i fent la volta al món, inspirat en el trajecte del Beagle que va fer Charles Darwin, va anar agafant mostres de l'aigua de diferents mars i oceans per aïllar i seqüenciar després el DNA que contenien.
  • Sintetitzar per primera vegada el genoma d'una espècie, en aquest cas el bacteri Mycoplasma genitalium, creant així un organisme nou (amb un missatge ocult inclòs en el seu genoma) batejat com Mycoplasma laboratorium.

Crec que qualsevol d'aquestes aportacions ja mereix per si sola el gran Premi ...

dijous, 27 de novembre de 2008

La privacitat genètica dels candidats presidencials

Ara que ja ha estat escollit el proper president dels EEUU semblava que estaríem un temps tranquils, ja que, en principi, les properes eleccions presidencials americanes no seran fins d'aquí 4 anys, al 2012. Però sembla que ja es comença a parlar de la campanya del 2012. En un article recentment publicat a la prestigiosa revista New England Journal of Medicine es fan ressò dels debats que hi hagut sobre la salut dels candidats i la conveniència o no de que els candidats facin públics alguns detalls mèdics sobre la seva salut o les malalties patides pels seus familiars més directes. I és que d'aquí a 4 anys es possible que la seqüenciació del genoma humà de cada individu sigui molt més factible. Fins i tot discuteixen que obtindre una mostra del DNA d'un candidat presidencial (i d'una persona qualsevol) podria resultar relativament fàcil. Un got d'una festa o recepció, per exemple, podria ser aprofitat pel candidat de l'altre bàndol per obtindre una mostra de DNA i fer un assaig genètic per intentar aprofitar la informació obtinguda en el seu favor. Quin tipus d'informació es podria fer sevir contra un candidat? Doncs la susceptibilitat de patir alguna malaltia o trastorn psiquiàtric. Què us sembla?

Post inspirat en http://thepersonalgenome.com/2008/11/presidential-dna-dont-ask-dont-tel/

divendres, 21 de novembre de 2008

Ciencia amb humor (vii) - Genoma i comerç

Continua la saga de les vinyetes còmiques sobre la seqüenciació del genoma humà. Ara sobre els aspectes més comercials.
















dilluns, 17 de novembre de 2008

Bioinformatica i Playstation


Necessiteu una excusa per a comprar o que us regalin una Playstation3? Aquí en teniu una: Cada cop es fa servir més per fer Ciència. No, no és broma. Resulta que la gran potencia de càlcul del processador (anomenat Cell Broadband Engine, Cell BE) juntament amb el seu preu assequible, fan que sigui una opció interessant per a executar programes informàtics que requereixen una gran quantitat de càlculs. Així per exemple, alguns dels algoritmes bioinformàtics més usuals s'han implementat ja per poder-los executar en una Playstation 3. Algunes de les implementacions ja existents o en desenvolupament són:
De fet, una de les primeres notícies que vaig tenir sobre aquesta utilització provenia d'un grup de recerca de l'IMIM-UPF. Aquest grup ha iniciat el que s'anomena PS3GRID, una xarxa d'usuaris de videoconsoles que vulguin col·laborar en investigacions científiques. Consisteix en instal·lar un petit programa en una Playstation3, i cedir la potència de càlcul de la màquina durant les estones que està en marxa però en les que l'usuari no l'està fent servir, i col·laborar així en la recerca científica, en aquest cas sobre simulacions moleculars que estudien el plegament de les proteïnes. No és la única iniciativa de xarxa d'usuaris que cedeixen les seves CPUs. Al projecte Folding@Home també dedicat a la comprensió del plegament i agregació de les proteïnes i les malalties relacionades, es pot contribuir des de qualsevol ordinador i sistema operatiu. Però és a través de la Playstation3 que reben més resultats, tot i tenir menys usuaris. I qui no recorda el projecte SETI, l'impulsor d'aquest tipus de xarxes, en aquest cas per la recerca de vida extraterrestre.

dimarts, 11 de novembre de 2008

Ciencia amb humor (vi) - Les implicacions etiques i morals de la seqüenciació del genoma humà

Aquí continua les vinyetes còmiques en relació amb la seqüenciació del genoma humà. Aquí trobareu totes aquelles vinyetes més relacionades amb els aspectes ètics. I és que l'ús (o millor dit el mal ús) que es pot derivar de la informació continguda en el genoma humà, sempre ha estat un motiu de preocupació per a la societat. De fet al voltant d'un 4% del pressupost del consorci públic es va dedicar a l'estudi de les implicacions ètiques, legals i socials (Ethical, Legal, and Social Implications -ELSI-). De fet, el fet de dedicar un percentatge del pressupost per aquestes qüestions ho va improvisar el primer president del consorci públic, el famós James Watson, durant una conferència de premsa. Va dir:"El 3% dels diners nostres haurien de dedicar-se a temes ètics. Si us digués el 1%, la gent pensaria que és purament simbòlic, S us digués el 20% la gent pensaria que estic boig." Al final va ser un 4%.






















dijous, 6 de novembre de 2008

Personal genomes

Un dels temes recurrents últimament en aquest blog ha estat el de la seqüenciació del genoma humà. Doncs bé, avui hi ha hagut novetats importants en aquest camp, i és que avui la revista Nature publica diversos articles etiquetats com a "Personal genomes" (Genomes personals), relacionat amb la idea de que algun dia serà econòmicament viable la seqüenciació del genoma humà de cada individu. Fins avui, podem dir que hi havia 4 genomes humans completament seqüenciats:
Doncs bé, avui a la revista Nature apareixen ni més ni menys que dos nous genomes completament seqüenciats:A més però, es presenta la seqüenciació del genoma complert extret d'una cèl·lula d'un tumor i la seva comparació amb el genoma del mateix individu extret d'una cèl·lula no cancerosa.

En els dos casos el preu gastat en seqüenciar completament el genoma humà ha estat inferior als $500,000. Els avanços tècnics han estat crucials en la seqüenciació del genoma humà. Cal recordar que darrera de l'empresa Celera Genomics hi havia l'empresa de seqüenciadors abans anomenada PerKin Elmer, i que el genoma d'en James Watson va ser seqüenciat per demostrar el gran avanç tecnològic que representaven els nous seqüenciadors 454 de l'empresa Roche. Doncs en el cas d'avui, el desenvolupament de nous mètodes de seqüenciació del DNA ha permès obtenir aquestes noves seqüències.

Veieu també la notícia aperguda a Nature Review Genetics.

Un aspecte a tenir en compte quan es parla de seqüenciar completament un genoma, és el terme que s'anomena coverage. El coverage ens diu quantes vegades (de mitjana) s'ha seqüenciat cada base del genoma. Com que només es poden seqüenciar fragments relativament curts de DNA (d'uns 500 parells de base com a molt), per seqüenciar completament un genoma cal seqüenciar mil·lions de fragments curts i després ajuntar computacionalment els trossets. Això només es possible si els trossets es solapen, és a dir tenen seqüències en comú que han estat seqüenciades més d'un cop. Així per exemple un dels genomes anunciats avui s'ha seqüenciat amb un coverage de 36. Això vol dir que no només s'han hagut de seqüenciar més de tres mil mil·lions de bases (o més de sis mil mil·lions si parlem del genoma diploide), si no que ho hem de multiplicar per 36 per saber el nombre de bases que ha calgut seqüenciar.

Segur que aquests nous genomes avivaran les discussions ètiques relacionades amb l'accés a aquesta informació.

dilluns, 3 de novembre de 2008

Ciencia amb humor (v) - Més sobre el genoma humà

Aquesta secció continua amb les vinyetes còmiques relacionades amb la seqüenciació del genoma humà:
















dijous, 30 d’octubre de 2008

Noves notícies sobre l'home de gel

"Estem a la regió de l'Ötzal, als Alps tirolesos, en un punt situat en la frontera actual entre Àustria i Itàlia, fa al voltant de 5.000 anys. Un home provinent de la vall de Vinschgan es dirigeix cap al pas del Hauslabjoch, per intentar passar a l'altre costat de les muntanyes. Som a començaments de la tardor i el temps no és gaire bo. El nostre home va perfectament equipat per moure's per una zona que probablement coneix: porta unes sabates plenes de fenc per a mantenir els peus calents, un petit braser per transportar foc, una gruixuda samarra de fibres vegetals trenades i una gorra de pell per a protegir-se el cap. Hi ha, però, alguns detalls que indiquen que ha patit algun tipus de desastre: té el carcaix on guarda les fletxes trencat, les fletxes mateixes inservibles, l'arc inacabat, i és possible que vagi ferit i que s'hagi trencat algunes costelles. Té entre 20 i 30 anys, el cabell i els ulls foscos i fa al voltant d'un metre seixanta d'alçada. És possible que sigui un pastor que s'encarregava de guardar un ramat en els prats alpins durant l'estiu i que tot just hagi tornat al seu poblat, en el fons de la vall. No ho sabrem mai el que allí li ha passat; el cert és que ha perdut una part essencial del seu equipament i ara intenta creuar el difícil Hauslabjoch en unes condicions meteorològiques adverses. A més de tres mil metres d'altura, es troba enmig d'una forta tempesta de neu. Cada cop més esgotat, es dirigeix cap a una fondalada arrecerada per unes cornises rocalloses; deixa l'arc recolzat contra unes roques i s'estira exhaust sobre la neu. En poc temps passa de la inconsciència a la mort, i la neu l'acaba cobrint amb una capa fina. Probablement, la capa de neu el va ocultar de la mirada dels ocells carronyaires, mentre que l'aire sec de les muntanyes va afavorir la ràpida deshidratació del cos i en va evitar la descomposició. Amb l'arribada de l'hivern, va quedar definitivament sepultat en el gel."
Extret del llibre "Missatges del passat" de Carles Lalueza. Edicions Bromera 1999

Quan el dia 19 de Setembre de 1991, el matrimoni format per Erika i Helmut Simon va trobar en un glacial de la vall d'Ötz el cadàver d'un home de mitjana edat, res podia fer imaginar que es tractava de l'ésser humà de major antiguitat trobat pràcticament intacte. La mòmia u home de gel, batejat com a Ötzi o Öetzi, va passar més de 5.000 anys sota el gel. La troballa de l'home de gel va tenir una gran repercussió mediàtica. De fet, va aparèixer entre les 25 personalitats més famoses de l'any 1991, en companyia, entre d'altres d'Elizabeth Taylor, la princesa Diana, George Bush pare i Magic Johnson. El seu excel·lent estat de conservació i un gran nombre d'objectes i roba d'ús quotidià trobats al seu costat va permetre a un grup interdisciplinari de científics reconstruir la seva història (tal i com teniu explicada més amunt). Fins i tot, a partir de l'anàlisi del contingut del seu estómac, esbrinar quin va ser el seu últim àpat.

Un nombrós equip internacional, format per alguns dels millors especialistes en DNA antic, es va encarregar de portar a terme un estudi genètic per a intentar obtenir i seqüenciar DNA de l'Ötzi. Van seqüenciar un segment de 353 parells de bases del genoma mitocondrial que va revelar que tot i tenir dos variants (una C en comptes d'una T en les posicions 16.224 i 16.311 de la regió de control del DNA mitocondrial) relativament poc freqüents, era típicament europeu. És a dir, que la seqüència de DNA mitocondrial que van obtenir, era igual a la d'alguna població europea actual. De fet, tal i com em va dir en persona al 1998 a Cambridge, en Svante Pääbo, un dels experts en DNA antic que van participar en l'anàlisi del DNA de l'Ötzi, quan li vaig preguntar sobre el tema, 5.000 anys eren pocs anys en termes evolutius per observar gaires canvis en una regió de DNA tan petita. Amb aquests resultats era possible que hi hagessin descendents (si en va tenir) actuals de l'Otzi (o altres humans emparentats amb ell).

Avui l'Ötzi, ha tornat a l'actualitat. S'ha publicat a la revista Current Biology la seqüenciació de tot el genoma mitocondrial de l'Otzi. Ha resultat que les variants en el DNA mitocondrial de l'Otzi són úniques i no es corresponen completament a cap població humana actual o seqüència humana mai trobada. Això vol dir que possiblement pertanyia a una població humana avui extingida, és a dir que no va deixar descendents. Els titulars ja els podeu imaginar: "Ancient mummy has no modern children" (L'home de gel no té descendència actual). Encara que com que els mitocondris només es transmeten de mares a fills, potser hauríem de dir que en l'actualitat no queden descendents de la mare de l'Otzi.

dilluns, 27 d’octubre de 2008

La Ciència de la ciència ficció


Una manera divertida d'apropar-se a la ciència és a través dels llibres o pel·lícules de ciència ficció. Ho podem fer de diverses maneres, poques vegades però podem fer-ho analitzant si les "prediccions" que es fan s'han acomplert o no. Aquest estiu he aprofitat per rellegir alguna novel·la i en el llibre "Hacia la fundación" de l'escriptor Isaac Asimov he trobat una cosa que m'ha cridat l'atenció. Es tracta d'una cosa molt colateral que no té cap mena d'importància en el fil argumental del llibre. En un moment del llibre el protagonista descobreix que la seva neta té poders telepàtics i decideix buscar a més gent amb aquests poders. Per fer-ho el que se li acudeix és seqüenciar el genoma complert de la seva neta per a buscar algú patró que permeti, analitzant els genomes complerts d'altres individus, trobar altres persones amb poders telepàtics. En un moment de la conversa entre el protagonista i la biofísica (¿?) a la que acudeix per obtenir la seqüència complerta, la doctora diu:

-"... manejar una molècula de ácido desoxirribonucleico desplegando miles de millones de nucleótidos y haciendo que cada purina y pirimidina esté en su sitio, es la parte menos complicada del proceso. Después hay que estudiar y comparar toda la información.
-"¿Por qué hay tan pocos genomas completos?"
pregunta el protagonista.
I la Doctora respon -"Por varias razones, y una de ellas es lo caro que resulta el proceso. Muy pocas personas están dispuestas a gastar tantos créditos a menos que tengas motivos muy sólidos para pensar que algo anda mal en su genoma ...."

En aquest cas la realitat sembla que superarà la ficció doncs sembla que a mitjà termini es pugui aconseguir l'objectiu de seqüenciar el genoma complert d'un individu per 1000$. L'escriptor després afina una mica més, doncs el genoma complert de la seva neta no li serveix per aconseguir el seu objectiu doncs com molt bé li descriu la Doctora, el funcionament del cervell depèn de milers de gens i trobar un patró genètic concret en aquest cas era del tot impossible. Sovint la solució més senzilla és la millor. Sabeu com troben a la novel·la més persones amb capacitats telepàtiques? Doncs dient telepàticament vine aquí. La persona que ho sent i acudeix és la que té els poders telepàtics....

La novel·la va ser escrita al 1993 i té el seu mèrit predir que arribaríem a poder seqüenciar un genoma complert humà. Deixeu-me parlar una mica de l'autor, l'Isaac Asimov.
Era un dels grans escriptors de ciència ficció però va escriure de tot: ciència ficció, llibres de divulgació científica, d'història, .... Era bioquímic i es va dedicar durant un cert temps a la recerca. La seva contribució a la recerca, però, no va ser gaire exitosa i finalment va dedicar tot el seu temps a l'escriptura. En la base de dades Medline podeu trobar els articles científics que va escriure. No són gaires. De l'època en que es dedicava a la recerca també hi han una sèrie d'articles a la revista "The Journal of Chemical Education". També va donar classes de bioquímica a la Facultat de Medecina de la Universitat de Boston. Va estar donant classes uns 8 anys i segons diu a les seves memòries era el millor professor de la Facultat (els estudiants l'aplaudien i tot quan acabava). És possible, doncs era un gran divulgador. Resulta però que al final el degà de torn el va voler fer fora perquè no es dedicava a la recerca. Com que tenia un càrrec de professor fixe, no el va poder fer fora, però li van deixar de pagar i ell va deixar de donar classes. Va conservar però el títol de professor.
Nomenar totes les contribucions d'Isaac Asimov seria molt llarg. Només en destaco dues, la trilogia de novel·les de ciència ficció coneguda com la trilogia de la "Fundació". De fet després de la trilogia va escriure molt relats curts relacionats i quatre novel·les més de la sèrie, dues que la continuaven i dues que la precedien (la novel·la que feia referència anteriorment era una d'aquestes últimes). En conjunt aquesta part de la seva obra la podem anomenar com "la saga de la Fundación". La segona contribució que vull destacar són els seus relats sobre robots. Diuen que el robot de Honda "Asimo" deu el seu nom a ell. La pel·lícula "El hombre bicentenario", protagonitzada per Robin Williams, és una adaptació d'una novel·la seva, i "Yo, robot" de l'actor Will Smith, encara que no està basada en cap novel·la d'Asimov, està inspirada en la seva obra. Són famoses les seves tres lleis de la robòtica que són:
  1. Un robot no puede dañar a un ser humano ni, por inacción, permitir que éste sea dañado.
  2. Un robot debe obedecer las órdenes dadas por los seres humanos excepto cuando estas órdenes entren en conflicto con la Primera Ley.
  3. Un robot debe proteger su propia existencia hasta donde esta protección no entre en conflicto con la Primera o la Segunda Ley.

Potser algun dia els robots portaran aquestes lleis .....

dimecres, 22 d’octubre de 2008

La guerra dels genomes i ciencia amb humor (iv)

Avui us explicaré una història antiga, de fa quasi 10 anys. Es tracta de la "competició" que va tenir lloc a finals dels 90s per a seqüenciar el genoma humà. Competició o guerra, segons com es miri. Posem-nos en situació. L'any 1990 es van donar els condicionants adients (tècnics, científics i polítics) per a què comencés als EEUU el Projecte per a Seqüenciar el Genoma Humà. Pels medis de l'època, el repte era molt important: Seqüenciar els més de tres mil milions de parells de bases (A, C, T, G) del genoma humà. Si escrivíssim aquestes bases en una sola línia amb un tipus de lletra times 12, la línia tindria una longitud de 5.000 km, la distància de Montreal a Londres. Cal recordar que en l'any 1990 no s'havia seqüenciat el genoma de cap ésser viu (tret dels d'alguns virus, que tenen un genoma molt més petit). Els beneficis, principalment mèdics, que havia de reportar la seqüència complerta del genoma humà eren molts. La previsió inicial era tenir un esborrany en 15 anys.

Més endavant, a aquest projecte es van afegir altres països (Espanya no, és clar) i es va crear un "Consorci públic" que va anar treballant. El desenvolupament de nous aparells per a seqüenciar el DNA va fer que s'avancés a una velocitat més gran de la inicialment prevista, i que s'obtingués també la seqüència d'altres organismes models. Per exemple, al 1995 es va seqüenciar el genoma del bacteri Haemophilus influenzae, al 1996 el genoma del llevat Saccharomyces cerevisiae, al 2000 el genoma de la mosca de la fruita (Drosphila melanogaster), ... També va contribuir el fet de que al 1998, el científic Craig Venter fundés l'empresa privada Celera Genomics i que fes l'anunci de que seqüenciarien el genoma humà en només tres anys. Va ser en aquest moment quan va començar la "guerra" entre el consorci públic i una companyia privada. Va ser una guerra sense regles, molts cops bruts, amb declaracions creuades, amb barreja de política, enveges, ..... Les diferències entre els dos bàndols no podien ser més grans. El consorci públic es financiava amb diners públics i propugnava que els resultats de la recerca (és a dir, la seqüència del genoma humà) havia de ser pública. De fet, cada dia a les 24:00 h, posava a través d'Internet les seqüències que s'havien seqüenciat aquell dia. La companyia privada per contra, es financiava amb diners privats i propugnava que no faria pública la seqüència del genoma humà i que la faria servir per als seus propis interessos. A més, però, hi havia diferències metodològiques entre els dos. El consorci públic feia servir una estratègia ordenada a l'hora de seqüenciar els diferents fragments del genoma humà, mentre que Celera feia servir la tècnica anomenada Shotgun (o escopeta genòmica) que consistia en una seqüenciació a l'atzar de fragments.

Al final, però, es va firmar un armistici i en conferència de premsa conjunta (fes click aquí per sentir-la), el 26 de Juny del 2000, es va presentar l'esborrany del genoma humà (millor dit els dos esborranys, un del Consorci públic i un de la companyia Celera). Encara que no va ser fins al febrer del 2001 que es van publicar els resultats en una revista científica. En aquest fet també hi van haver diferències. El consorci públic va publicar el seu esborrany el dia 15 de febrer del 2001 a la revista anglesa Nature, i la companyia privada, el 16 de febrer del 2001 a la revista americana Science.

Aquesta és la història, una mica simplificada, del que va succeir. La competició entre els dos bàndols va ajudar a que s'obtingués la seqüència més aviat, encara que el preu va ser també molt superior. L'obtenció de la seqüència del genoma humà va tenir una gran repercussió mediàtica i es va arribar a comparar amb l'arribada de l'home a la lluna. A tall d'exemple, i continuo així la secció de Ciència amb humor, veieu algunes tires còmiques en relació a aquest fet:












diumenge, 19 d’octubre de 2008

Us tradueixo del francès un conte:
Fa molt de temps, en una província de Xina, hi havia un pintor que dibuixava d'un sol traç nenúfars, ocells i total mena d'animals. Els seus dibuixos eren tan bonics que era conegut per tota la seva província. Un dia, va arribar a orelles de l'Emperador la fama del dibuixant, i va manar que el portessin al seu palau.
- "M'han dit que ets el millor pintor de tot l'imperi i ho vull comprovar. T'ordeno que em dibuixis .... un ... un cigne, hi ha de ser el cigne més bell que així vist mai. Si ho fas, et faré l'home més ric del país. Quan de temps necessites per dibuixar el cigne?" li va dir l'Emperador.
- "Necessitaré deu anys" li va contestar el pintor.
- "Deu anys .... per dibuixar un cigne?" li va replicar l'Emperador.
- "Deu anys per dibuixar el cigne més bell que hageu vist mai, senyor".
- " .... Bé, bé" va replicar l'Emperador a contracor. "Ho accepto. Jo mateix vindré d'aquí a deu anys a casa teva per a que m'ensenyis aquest cigne".
Els anys van anar passant, i quan es compliren els deu anys, l'Emperador es va presentar a la casa del dibuixant i li va dir,
- "Vinc a buscar el meu cigne, espero que deu anys hagin estat suficients per a que el puguis haver dibuixat".
- "Ara mateix" li va dir el pintor. I tot seguit va agafar un full blanc i un pinzell, i davant l'atenta mirada de l'Emperador i el seu seguici, va dibuixar d'un sol traç un preciós cigne.
L'Emperador es va quedar parat. En realitat era el cigne més bonic que havia vist mai, però estava enfurismat.
- "Agafeu al pintor i porteu-lo a la presó. Què s'ha pensat que es pot riure de mi? Em demana deu anys per pintar el cigne i quan arribo aquí, va i me'l dibuixa en 10 segons." va dir l'Emperador.
El pintor no va dir res, i quan es disposaven a sortir tots cap a Palau, el fill de l'Emperador va cridar "Pare, pare, has de veure això, vine". El cridava des d'una petita habitació que hi havia al costat d'on eren. Era la cambra on dibuixava sempre el pintor. Quan va entrar l'Emperador, va veure per damunt la taula, per terra, cobrint totes les parets, milers i milers de fulls amb milers i milers de cignes dibuixats. El pintor havia estat 10 anys, dia i nit, pintant cignes per ser capaç de dibuixar en presència de l'Emperador un cigne que fos digne d'ell. L'Emperador finalment ho va entendre i va recompensar al pintor.

Vaig llegir aquesta història fa anys, en relació a un guitarrista francès anomenat Marcel Dadi. Era un prodigi de la guitarra, en concret d'un estil anomenat Fingerpicking. En Dadi tocava amb una facilitat que semblava que allò que tocava no tenia cap mena de dificultat. Els que hem intentat alguna vegada tocar alguna de les seves peces, ens n'hem adonat que com el pintor, darrera de cada nota d'en Marcel i havia anys i anys de pràctica i paciència. Tot sovint volem recollir els fruïts just després de sembrar i no ens n'adonem que és allò que ens costa més esforç el que després valorarem més.

Aquí us deixo alguns vídeos del genial Marcel Dadi:




dimarts, 14 d’octubre de 2008

Predisposicio genetica a la calvicie

Sempre he cregut que la calvície era un exemple de trastorn associat als cromosomes sexuals. Els homes i les dones ens diferenciem en els cromosomes sexuals (l'últim parell, el parell 23, dels cromosomes). Mentre que les dones tenen dues còpies del cromosoma X (són per tant XX), els homes tenen un cromosoma X (sempre heretat de la mare) i un cromosoma Y (molt més petit i heretat del pare). Què passa doncs si hi ha un gen associat a una malaltia o trastorn en el cromosoma X? Si aquest trastorn és recessiu, és a dir calen dues còpies per a que es manifesti (al contrari de dominant, on només caldria tenir una còpia amb el trastorn per a que es manifestés), resulta que hi pot haver dones sanes (amb les dues còpies del gen intacte), dones sanes i portadores (una còpia intacta i l'altra amb la variant associada a la malaltia) i dones malaltes (amb les dues còpies de la variant associada amb la malaltia), Però que passa amb les homes? Al tenir només un cromosoma X, només poden ser malalts o sans. És per això que certs trastorns o malalties poden ser més freqüents en els homes. Doncs la calvície és un d'aquests casos. AL 2005 uns científics alemanys varen identificar un gen (AR, que codifica pel receptor dels andrògens) relacionat amb la calvície localitzat en el cromosoma X. Això explica la més alta incidència de la calvície en els homes. El que no explica però aquest gen, és la transmissió genètica de la calvície que s'observa alguns cops del pare al fill (recordeu que el cromosoma X dels homes l'heretem de la mare). Ahir es va aclarir una mica més el tema, doncs dos grups d'investigadors britànics (amb col·laboració amb l'empresa DeCode, la mateixa que vàrem parlar quan parlàvem dels tests genètics) i alemanys han publicat la troballa d'una alteració genètica en el cromosoma 20 associada amb la calvície. A més, els individus que tinguin les dues alteracions (la del cromosoma X i la del cromosoma 20) sembla que tenen un risc 7 vegades més gran de patir calvície.

Els americans que fan negoci de tot, fa un cert temps que ofereixen un test genètic (preu 249$) per detectar el possible risc de calvície (en diferents graus) en els homes i en les dones. L'empresa que ofereix aquest servei s'anomena HairDX i fins ara feien una anàlisi del gen del cromosoma X associat amb la calvície. No sabem si també inclouran ara un anàlisi de la variant localitzada en el cromosoma 20.

Podeu llegir també la notícia apareguda a EL PAIS.

dissabte, 11 d’octubre de 2008

Una manera divertida d'apendre la taula periòdica

No és que m'enyori dels meus temps d'estudiant de Química, al contrari, tant de bo hagués tingut una eina com la que aquí us presento quan vaig haver d'estudiar la taula periòdica. A la Universitat de Nottingham trobareu "The Periodic Table of Videos". Consisteix en una explicació de cada element de la taula periòdica a través de vídeos curts on hi ha alguna explicació i fins i tot alguna demostració en alguns d'ells. Us deixo amb el vídeo de l'element C subtitulat al castellà, aquí trobareu alguns dels altres vídeos amb subtítols. No us perdeu la "pinta" d'un dels científics que ho explica, una prova més del tòpic de que els científics no són gaire sexis:


Altres vídeos sobre la taula periòdica els podeu trobar en altres blogs, com per exemple en el blog Globin77.

dimecres, 8 d’octubre de 2008

El premi Nobel de Química 2008 a tres bioquímics

Avui mateix s'acaba de fer públic els tres guardonats pel Premi Nobel de Química 2008. Els afortunats són els americans Osamu Shimomura, Martin Chalfie i Roger Y. Tsien que han estat guardonats "pel descobriment i desenvolupament de la proteïna florescent GFP (green fluorescent protein)". Aquesta proteïna GFP es tracta d'una proteïna trobada en la medusa Aequorea victoria que emet llum verda sota la llum ultraviolada. La descoberta, purificació, caracterització i modificació d'aquesta proteïna ha permès utilitzar-la en molts experiments en les àrees de bioquímica, biologia molecular, medicina o biotecnologia. De fet en la informació científica que acompanya l'anunci del Premi es destaca que des de la seva caracterització al 1992 s'han publicat més de 20,000 articles en relació a aquesta proteïna.

Podeu veure en el següent vídeo algunes de les aplicacions més sorprenents i visualment més boniques de la utilització d'aquesta proteïna (també podeu trobar més informació sobre aquesta proteïna en el seu propi espai a la web):


Per a mi també és destacable que el Premi Nobel de Química vagi a parar (i ja en són uns quants) a científics que desenvolupen la seva carrera investigadora en el camp de les BIOciències.

dilluns, 6 d’octubre de 2008

Premis Nobel, HPV i Ciència amb humor (III)

Avui s'ha fet públic els guanyadors del Premi Nobel de Fisologia o Medicina 2008. Hi han hagut tres guanyadors. Una meitat del premi ha estat per l'alemany Harald zur Hausen pel descobriment de que cert tipus de papillomavirus humans són els causants del càncer cervical o càncer del coll de l'úter. L'altre meitat del premi se'l reparteixen els francesos Françoise Barré-Sinoussi i Luc Montagnier pel descobriment del virus del sida (VIH). Segur que el premi portarà certa polèmica per la no inclusió de l'investigador nord-americà Robert Gallo. Podeu llegir la notícia El PAIS i una breu història sobre la polèmica del descobriment del VIH a l'altre costat de la lent. Com que crec que la part del Premi corresponent al descobriment del VIH serà més comentat, i a més, he fet alguna recerca sobre l'evolució dels virus del Papilloma humà (HPV), em fa gràcia explicar-vos alguna cosa sobre el HPV:

El Papillomavirus és un virus de DNA que infecta la pell i mucoses dels humans i altres animals. S'han identificat centenars de tipus diferents d'aquests virus, alguns d'ells causen berrugues i altres, càncer del coll de l'úter i altres tipus de càncer en els genitals. El descobriment de la relació entre certs subtipus d'aquest virus i el càncer del coll de l'úter (els anomenats subtipus HPV 16 i HPV 18 són causants del 70% de casos d'aquest càncer) va ser un fet important i va portar a desenvolupar fa poc temps una vacuna contra aquest tipus de càncer. De fet és el primer tipus de càncer que s'ha associat a un virus, i del que s'ha desenvolupat una vacuna. La vacuna anomenada 'Cervarix' no està però exempta de certa polèmica referent al seu preu, la conveniència o no de incloure-la en el calendari de vacunacions, i fins i tot per qüestions religioses.
Tornant al virus del HPV, es tracta d'un virus amb relativament poc contingut de DNA. El seu genoma codifica per les proteïnes L1 i L2 (L perquè s'expressen en les fases posteriors de l'infecció -late-) que corresponen a les proteïnes de la càpside del virus, i les proteïnes E1, E2, E4, E5, E6 i E7 (E perquè s'expressen en les primeres fases -early- de la infecció) i involucrades en la replicació i amplificació del virus i en altres etapes del seu cicle infectiu.



La meva petita contribució a l'estudi d'aquests virus, ha estat (en col·laboració amb el Dr. Ignacio González Bravo i el Dr. Pere Puigbò Àvalos) relativa a la classificació d'aquests virus, la diferent taxa de divergència de cada part del genoma, les seves regions reguladores, l'anotació d'alguns dels seus gens i en general en la seva evolució.

Us deixo amb una vinyeta divertida sobre els Premis Nobel. El text diu una cosa com "Va una mica de sobrat. Cada cop que es canvia de casa, envia la nova adreça al comité dels Premis Nobel".


diumenge, 5 d’octubre de 2008

Art i DNA

No sabeu quin regal fer a una persona estimada? Si li agrada la biologia molecular i el DNA, aquest regal segur que li agradarà. L'empresa DNA 11, ofereix una sèrie de quadres com el de la imatge, que representen una electroforesi de DNA (tècnica per separar fragments de DNA, utilitzada molt freqüentment en els laboratoris de biologia molecular). Els quadres però són personalitzats. Això vol dir que tu els hi envies una mostra de saliva i l'empresa crea el quadre a partir de la informació del teu genoma (una sèrie de variants entre la població que fan que el patró de bandes de l'eletroforesi sigui diferent per a cada persona). De fet, aquest és el fonament de la identificació de persones, tests de paternitat, .... mitjançant l'anàlisi de DNA. Així, ben segur que el quadre que compres serà original i no el tindrà ningú més (o quasi ningú). Podeu trobar una galeria del que ofereixen en l'adreça següent. Què us sembla?

dijous, 2 d’octubre de 2008

Ciencia amb humor (ii)


Un post recent d'un blog amic m'ha fet pensar sobre la relació que s'estableix entre el doctorand i el director de la seva tesis doctoral. El doctorand sol començar sempre amb molta il·lusió però sense saber a on es posa. A mesura que passa el temps es va fent un expert en el tema que desenvolupa i al final, si tot ha sortit bé, acaba sent un expert. Podríem dir que fins i tot, al final, en allò concret que ha tractat en la seva tesis, en sap més que el seu director.

Aquí us deixo una tira còmica on reflecteix el canvi d'un doctorand al llarg dels quatre anys de tesis. Representa una conversa entre el doctorand (que veiem en la tira) i el seu director. En el primer any el doctorand diu que sí ha tot el que diu el director. En el segon, Diu "Sí, però", "Però què" contesta el director" "Res" acaba dient el doctorant. En el tercer any el doctorand diu "Sí", però pensa "Això és una complerta pèrdua de temps", i en l'últim any, el director directament ja li pregunta "No faràs això que et dic, oi?" i el doctorand sense embuts li diu "Sí" volen dir que directament no farà el que el seu director li està proposant.


La tira està extreta del lloc PhD Comics. Us el recomano.

dilluns, 29 de setembre de 2008

DNA d'espècies extingides


Es possible obtenir el DNA d'espècies extingides? Doncs sí. És pot fer a partir de fòssils o mostres d'animals de museus (si són espècies que s'han extingit fa poc com el Tigre de Tasmània). De fet hi ha una bona colla de seqüències de DNA d'espècies extingides en les bases de dades de seqüències. Aquí teniu un enllaç on podeu trobar aquestes seqüències. De fet hi ha un projecte en marxa liderat pel Dr. Svante Paabo del Max Planck Institute de Munich per seqüenciar el genoma complert dels Neardentals a partir de restes fòssils, trobades entre altres llocs a la cova de "El Sidrón" a Astúries.

I el DNA d'un dinosaure? Coneixeu l'argument de "Jurassic Park", oi? A partir dels mosquits retinguts a l'interior d'un ambre fossilitzat, un grup de científics es capaç d'extreure el DNA de diverses espècies de dinosaures i clonar-los. El que potser no sabreu és que en el llibre, l'autor Michael Crichton va incloure una seqüència de DNA, suposadament de dinosaure.



És realment aquesta seqüència de DNA de dinosaure? Com ho podríem saber? Ja us he esmentat en algun altre post que existeix una eina bioinformàtica, anomenada blast, per comparar una seqüència de DNA o proteïna amb totes les seqüències fins ara conegudes i que trobem en les bases de dades de seqüències. Que passa si comparem la seqüència suposadament de dinosaure que apareix al llibre de Jurassic Park amb les bases de dades de seqüències de DNA? Doncs això és el que va fer en Mark Boguski al 1992. Si ho feu trobareu que no es tracta d'una seqüència real de dinosaure, si no que es tracta d'una seqüència derivada del plàsmid pBR322 (una seqüència de DNA creada per l'home i molt utilitzada en Biotecnologia). En Mark va publicar la seva troballa a la revista Biotechniques.

La història però continua. Resulta que l'autor de Jurassic Park, Michael Crichton, va veure l'article i va escriure a en Mark dient-li que efectivament no es tractava del DNA d'un dinosauri i que no s'hagués pensat mai que algú mai ho comprovaria. També li deixava anar que si algú li proposava una seqüència de DNA real de dinosaure, l'incorporaria en altres edicions del llibre. En Mark va acceptar el repte i va preparar una seqüència suposadament de dinosaure. Aquesta seqüència va aparèixer en la segona part de la saga, titulada "El mundo perdido". Si feu un blast d'aquesta seqüència de DNA, descobrireu que és més possible que sigui de dinosaure, doncs a les seqüències que més s'assembla són dues seqüències de pollastre i granota (és el que s'esperaria trobar si partim de la hipòtesis de que els dinosaures estaven emparentats amb els rèptils i aus). En Mark, però va introduir un missatge ocult en aquesta seqüència de DNA. Si traduïm a proteïna i comparem la seqüència resultant amb la proteïna de pollastre que era la més semblant, descobrireu el missatge MARK WAS HERE NIH que traduït al català seria "En Mark ha estat aquí, NIH" (NIH són els National Institute of Health on treballava).



Aquesta història és la que tenia pendent explicar-vos en un dels meus posts anteriors sobre "missatges ocults en els genomes".

dissabte, 27 de setembre de 2008

Premis i competicions cientifiques (ii)


Seguint amb els premis i competicions científiques, en concret amb els anomenats X Prize. La X Prize Foundation acaba d’engegar una competició en la que tots hi podeu participar. Es titula “What’s Your Crazy Green Idea?” (Quina és la teva boja i verda idea) i es tracta d'elaborar un vídeo de 2 minuts màxim de durada proposant com hauria de ser el proper premi X prize sobre Energia i medi ambient (Energy and Environment). És a dir, es tracta de proposar que cal promoure (quina recerca, desenvolupament tecnològic, ....) per millorar en aquest camp. Els vídeos dels participants són penjats al YouTube i teniu temps fins el 31 d’Octubre per a participar-hi. El premi 25,000$. Aquí us deixo un vídeo explicatiu de la competició.



Ja hi ha alguns vídeos penjats, encara que alguns no han entès bé de que es tracta.

Sort si participeu.

dijous, 25 de setembre de 2008

Ciencia amb humor 1


Comencem una nova secció titulada Ciència amb humor on anirem penjant dibuixos (cartoons) relacionats amb la ciència.

Aquí us deixo el primer, relacionat amb el post on parlàvem dels tests genètics.

La vinyeta representa una entrevista de feina de l'any 2010. L'entrevistador li explica que dels resultats del test genètic veuran la seva predisposició a algunes malalties i que estan treballant en trobar el gen de "treballar moltes hores i cobrar poc".

dilluns, 22 de setembre de 2008

Tests genetics


El dia 9 de Setembre la companyia 23andMe ha anunciat una baixada de preus, des de 999$ fins 399$, del servei que ofereixen. Aquest servei no és altre que un test genètic. A través d'una mostra de saliva que s'envia a la companyia, t'envien els resultats d'un test genètic que et mostra entre altres coses: susceptibilitats de patir alguna de les malalties que tenen un cert component genètic, informació sobre els teus ancestres (si tens per exemple una variant en una part del teu genoma que per exemple és més comú entre els esquimals), comparació del teu DNA amb familiars o amics que també s'han fet el test, i altre informació que es pot extreure de l'anàlisi del DNA d'una persona. En el blog del Pere Estupinyà, ja ens explicava que recentment l'empresa havia organitzat una festa on anava recollint mostres de saliva dels convidats il·lustres i els hi regalava els resultats del seu test. L'empresa 23andMe és propietat de la dona d'un dels fundadors de Google, Sergey Brin. Doncs fa tres dies que en el mateix blog del Sergey Brin, aquest anuncia que s'ha fet un dels tests genètics de la companyia i que els resultats mostren que té una mutació, la G2019S, en el gen LRRK2 que el predisposa a patir la malaltia de Parkinson, com pateix la seva mare. Ell explica que es va fer el test com a diversió i que no s'esperava que li donessin una notícia com aquesta. En aquest cas, com molts altres resultats d'aquests tests genètics, el resultat només és una predisposició més alta de l'habitual a patir una determinada malaltia. Cal no treure de context els resultats d'aquests tipus de test i que t'ho expliquin molt bé. Aquest tipus de notícies són difícils de pair i hi ha gent que segur no ho vol saber (de moment no hi ha cura per moltes d'aquestes malalties i a més pots tenir una variant que predisposa per una malaltia i no desenvolupar-la). El creador de Google, Sergey Brin, s'ho ha pres bé. Diu que considera que és una sort que disposi d'aquesta informació, doncs a partir d'ara es podrà preparar. De ben segur que a partir d'ara els diners dedicats a la recerca d'aquesta malaltia augmentaran. Podeu llegir la notícia a la web de Scientific American.

La companyia 23andMe no és l'única que ofereix aquests serveis. Altres companyies que ofereix aquests serveis són la companyia Islandesa deCODE genetics amb el seu servei anomenat deCODEme i les companyies Navigenics i DNAdirect.
Per finalitzar us deixo un vídeo que a mi m'ha agradat molt, explicant els resultats que et donen aquests tipus de tests (altre informació relacionada la trobareu aquí):


diumenge, 21 de setembre de 2008

La importància d'ensenyar a pensar (ii)


Us deixo una altra anècdota científica. Aquesta l'he tret d'un blog sobre educació infantil.
Richard Feynman, premi nobel de física, explicava la influència que havia tingut el seu pare, en el seu desenvolupament com a científic amb la següent anècdota:
Entre els veïns sempre es comentava que ell era tan espavilat perquè el seu pare constantment li estava ensenyant coses. Un dia, mentre jugava amb un amic al jardí, l’amic li diu: Mira quin ocell, com es diu? Richard li contesta: Ni idea! i l’amic sorprès li demana: Què no t’ensenya res, el teu pare? I sí. El seu pare li havia ensenyat i li havia parlat de l’ocell; però d’una altra manera.
Veus aquell ocell? és un “Spencer’s warbler” (em sembla que s’inventava el nom) en italià es diu Chutto Lapittida; en portuguès, és un Bom da Peida, en xinès és un Chung-long-tah .......... Podries saber el nom d’aquest ocell en tots els idiomes del món, però quan els haguessis après no sabries res més de l’ocell. Així que observa l’ocell i mira el que està fent i fes-te preguntes. Això és el que compta! D’aquesta manera el meu pare em mostrava la diferència entre només saber el nom de les coses i saber coses.

dimecres, 17 de setembre de 2008

Missatges ocults en els genomes

Podem representar l'ADN o molècula portadora de la informació genètica que es transmet de pares a fills, com una seqüència de quatre tipus de lletres (A,C,G,T) anomenades bases. L'ordre de les lletres és el que dóna sentit al missatge i permet el fenomen complex de la vida. Principalment aquest missatge contingut en l'ADN només serveix per a sintetitzar un altre tipus de molècules, les proteïnes, que són les que fan les "funcions" en les cèl·lules. Les proteïnes estan formades per la unió d'aminoàcids. Hi han 20 aminoàcids diferents (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y representat en aquest cas per la inicial del seus noms), i l'ordre en que cal ajuntar els aminoàcids per formar una determinada proteïna és el que està "codificat" en l'ADN com informació que es transmet de generació en generació. La clau per desxifrar o passar de l'ADN a la proteïna és que cada tres bases corresponen a un aminoàcid determinat. Així, donada una seqüència d'ADN, es genera una seqüència determinada d'una proteïna.

Si representem doncs una molècula d'ADN com una seqüència de les lletres A,C,G,T i una proteïna com una seqüència de (A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y podem jugar una mica amb els missatges en la nostra llengua que s'originen. Una seqüència dels quatre tipus de lletres (A,C,G,T) com és l'ADN no dóna gaire joc. Es poden formar paraules com CACA o TATA i poca cosa més. En canvi les seqüències de proteïnes donen molt més joc. Si tenim la sort que les lletres que formen el nostre nom coincideixen amb algun dels 20 aminoàcids (per exemple SANTI o VALLVE són possibles, però no ALBERT doncs no hi ha cap aminoàcid que comenci per la lletra B) podem encriptar el nostre nom o transformar-lo en una seqüència d'ADN. Per fer-ho només hem de saber quina correspondència hi ha entre les agrupacions de 3 bases amb cada aminoàcid. Això se'n diu codi genètic.
Taula amb el codi genètic:

Així per exemple SANTI el podríem transformar en TCTGCAAACACCATT (hi ha altres variants doncs hi han agrupacions de tres lletres que donen lloc al mateix aminoàcid).
Aquí teniu una petita aplicació que permet transformar una seqüència de proteïnes en una d'ADN:


I aquí una que us permet transformar una seqüència d'ADN en una de proteïnes:


Aquest joc és el que ha permès a alguns investigadors deixar "missatges ocults" o empremtes en alguna seqüència d'ADN. Aquí en teniu dos casos:

  • Aquest mateix any hem viscut una fita important en el camp que s'anomena biologia sintètica. Consisteix en sintetitzar químicament molècules d'ADN amb les característiques desitjades. Portat a l'extrem, podria significar sintetitzar el genoma (conjunt de tot l'ADN) d'un organisme i crear així noves espècies. Doncs és el que va fer el grup del Dr. Craig Venter del J Craig Venter Institute (Podeu llegir la notícia en un dels posts del blog del llindar). Va sintetitzar i empalmar químicament unes 580.000 bases d'ADN per formar el genoma d'un bacteri. En aquest cas, només va copiar íntegrament el genoma del primer bacteri que es va seqüenciar completament. Va introduir però 5 missatges ocults en forma de fragments d'ADN. Aquests fragments són: "gtagaaaaca ccgaacgaattaattctacgattaccgtgactgag", "tgtcgtgcaattggagtagagaacacagaacga", "catgcaatgtcgatgattacccac", "ggtctagctagtagcgcgaatgactgcctatacgatgag" i "tgcataaacg acatcgctaatgactgtctttatgatgaa". Si els tradueixes a proteïna trobaràs els missatges ocults. Cal dir que l'asimetrich ho va encertar de ple en un dels seus comentaris del post del llindar.
  • El segon exemple es mereix un post per ell sol que us explicaré un altre dia. Només us avanço que en un fragment d'ADN suposadament de dinosauri que apareix en la novel·la "El mundo perdido" de Michael Crichton, apareix el missatge ocult "MARK HAS HERE NIH".


La utilització d'altres eines bioinformàtiques més complexes, permet altres tipus de "jocs" més elaborats. Per exemple, existeixen eines (una d'elles es diu BLAST) per comparar una seqüència d'una proteïna amb les seqüències d'altres proteïnes ja conegudes i trobar així semblances. Podem agafar un nom, i per exemple buscar en quines proteïnes el trobem. Per exemple si fem un Blast del nom "VALLVE" trobem aquest fragment de seqüència en proteïnes de moltes espècies. Per exemple la mosca, bacteris i fins i tot en l'home. Si restringim a proteïnes humanes obtenim 28 proteïnes que contenen aquesta seqüència de lletres. Ara que no totes les cerques d'aquest tipus que podem fer donen un resultat tan bo com si busqueu el nom "SARAHPALIN" (Sarah Palin, el nom de la ultraconservadora republicana que es presenta com a vicepresidenta). La seqüència a la que més s'assembla el nom de "SARAHPALIN" és una proteïna del fong Botryotinia fuckeliana (Només cal que traduïu la paraula anglesa fuck per entendre la gràcia). Podeu llegir la història en el següent blog.