Tanquem l'any Darwin amb regals ....

Per acabar l'any Darwin algunes idees per fer un regal "evolutiu". N'hi ha per totes les edats i gustos. Bé, per tots els gustos (creacionistes o IDiots) potser no. Extret de l'"Evolver Zone", a resource for students, teachers, and researchers with an interest in evolution.

Gadgets sobre Bioinformatica

Aquí van una serie de Gadgets sobre Bioinformàtica molt útils desenvolupats per Your Lab Data. DNA to Protein

Translated DNA sequence to protein by using all genetic codes, including customised ones. All frames are translated.

Sequence Manipulation

The sequence is manipulate to remove non-coding characters, to get reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or may be converted to RNA.

Protein to DNA

Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.

Palindromic sequences finder Will search the sequence to find palindromic subsequences. Allows selection of minimum and maximum size of palindromic subsequences. Restriction digest of DNA

Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).

Sequence:

Show code

Min. recognition size for each enzyme 45678

Type of restriction enzyme AllBlunt endsOverhang end

Use only this endonuclease Select AarI AasI AatI AatII AbsI AccI AccII AccIII Acc16I Acc36I Acc65I AccB1I AccB7I AccBSI AciI AclI AclWI AcoI AcsI AcuI AcvI AcyI AdeI AfaI AfeI AfiI AflII AflIII AgeI AhdI AhlI AjiI AjnI AjuI AleI AlfI AloI AluI AluBI AlwI Alw21I Alw26I Alw44I AlwNI Ama87I Aor13HI Aor51HI ApaI ApaLI ApeKI ApoI AscI AseI AsiGI AsiSI AspI Asp700I Asp718I AspA2I AspEI AspLEI AspS9I AssI AsuC2I AsuHPI AsuNHI AvaI AvaII AviII AvrII AxyI BaeI BalI BamHI BanI BanII BanIII BarI BasI BauI BbeI BbrPI BbsI BbuI BbvI Bbv12I BbvCI BccI BceAI BcgI BciVI BclI BcnI BcuI BdaI BfaI BfiI BfmI BfrI BfuI BfuAI BfuCI BglI BglII BisI BlnI BlpI BlsI BmcAI Bme18I Bme1390I Bme1580I BmeRI BmeT110I BmgBI BmgT120I BmiI BmrI BmrFI BmtI BmuI BoxI BpiI BplI BpmI Bpu10I Bpu14I Bpu1102I BpuAI BpuEI BpuMI BpvUI BsaI Bsa29I BsaAI BsaBI BsaHI BsaJI BsaMI BsaWI BsaXI Bsc4I Bse1I Bse8I Bse21I Bse118I BseAI BseBI BseCI BseDI Bse3DI BseGI BseJI BseLI BseMI BseMII BseNI BsePI BseRI BseSI BseXI BseX3I BseYI BsgI Bsh1236I Bsh1285I BshFI BshNI BshTI BshVI BsiEI BsiHKAI BsiHKCI BsiSI BsiWI BsiYI BslI BslFI BsmI BsmAI BsmBI BsmFI BsnI Bso31I BsoBI Bsp13I Bsp19I Bsp68I Bsp119I Bsp120I Bsp143I Bsp1286I Bsp1407I Bsp1720I BspACI BspANI BspCNI BspDI BspEI BspFNI BspHI BspLI BspLU11I BspMI BspMAI BspOI BspPI BspQI BspTI BspT104I BspT107I BspTNI BspXI BsrI BsrBI BsrDI BsrFI BsrGI BsrSI BssAI BssECI BssHII BssKI BssMI BssNI BssNAI BssSI BssT1I Bst6I Bst98I Bst1107I BstACI BstAPI BstAUI BstBI Bst2BI BstBAI Bst4CI BstC8I BstDEI BstDSI BstEII BstENI BstF5I BstFNI BstH2I BstHHI BstKTI BstMAI BstMBI BstMCI BstMWI BstNI BstNSI BstOI BstPI BstPAI BstSCI BstSFI BstSLI BstSNI BstUI Bst2UI BstV1I BstV2I BstXI BstX2I BstYI BstZI BstZ17I Bsu15I Bsu36I BsuRI BsuTUI BtgI BtgZI BtrI BtsI BtsCI BtuMI BveI Cac8I CaiI CciNI CelII CfoI CfrI Cfr9I Cfr10I Cfr13I Cfr42I ClaI CpoI CseI CspI Csp6I Csp45I CspAI CspCI CviAII CviJI CviKI-1 CviQI DdeI DinI DpnI DpnII DraI DraII DraIII DrdI DriI DseDI EaeI EagI Eam1104I Eam1105I EarI EciI Ecl136II EclHKI EclXI Eco24I Eco31I Eco32I Eco47I Eco47III Eco52I Eco57I Eco72I Eco81I Eco88I Eco91I Eco105I Eco130I Eco147I EcoICRI Eco57MI EcoNI EcoO65I EcoO109I EcoP15I EcoRI EcoRII EcoRV EcoT14I EcoT22I EcoT38I EgeI EheI ErhI Esp3I FaeI FalI FaqI FatI FauI FauNDI FbaI FblI Fnu4HI FokI FriOI FseI FspI FspAI FspBI Fsp4HI GlaI GluI GsuI HaeII HaeIII HapII HgaI HhaI Hin1I Hin1II Hin4I Hin6I HinP1I HincII HindII HindIII HinfI HpaI HpaII HphI Hpy8I Hpy99I Hpy188I Hpy188III HpyAV HpyCH4III HpyCH4IV HpyCH4V HpyF3I HpyF10VI Hsp92I Hsp92II HspAI ItaI KasI KpnI Kpn2I KspI Ksp22I Ksp632I KspAI Kzo9I LguI LweI MabI MaeI MaeII MaeIII MalI MamI MbiI MboI MboII MfeI MflI MhlI MlsI MluI MluNI MlyI Mly113I MmeI MnlI Mph1103I MreI MroI MroNI MroXI MscI MseI MslI MspI Msp20I MspA1I MspCI MspR9I MssI MunI MvaI Mva1269I MvnI MvrI MwoI NaeI NarI NciI NcoI NdeI NdeII NgoMIV NheI NlaIII NlaIV NmeAIII NmuCI NotI NruI NsbI NsiI NspI NspV OliI PacI PaeI PaeR7I PagI PalAI PasI PauI PceI PciI PciSI PctI PdiI PdmI PfeI Pfl23II PflFI PflMI PfoI PhoI PinAI PleI Ple19I PmaCI PmeI PmlI PpiI PpsI Ppu21I PpuMI PscI PshAI PshBI PsiI Psp5II Psp6I Psp1406I Psp124BI PspCI PspEI PspGI PspLI PspN4I PspOMI PspPPI PspXI PsrI PstI PsuI PsyI PvuI PvuII RcaI RgaI RigI RsaI RsaNI RseI RsrII Rsr2I SacI SacII SalI SanDI SapI SatI Sau96I Sau3AI SbfI ScaI SchI ScrFI SdaI SduI SetI SexAI SfaNI SfcI SfiI SfoI Sfr274I Sfr303I SfuI SgfI SgrAI SgrBI SgrDI SgsI SinI SlaI SmaI SmiI SmiMI SmlI SmoI SmuI SnaBI SpeI SphI SrfI Sse9I Sse8387I SseBI SsiI SspI SstI SstII StrI StuI StyI StyD4I SwaI TaaI TaiI TaqI TaqII TasI TatI TauI TfiI TliI Tru1I Tru9I TseI TsoI Tsp45I Tsp509I TspDTI TspEI TspGWI TspMI TspRI TstI Tth111I Van91I Vha464I VneI VpaK11BI VspI XagI XapI XbaI XceI XcmI XhoI XhoII XmaI XmaCI XmaJI XmiI XmnI XspI ZraI ZrmI Zsp2I

Only use enzymes with known bases (no N,R,Y...)

Include Type IIb restriction enzymes

Include Type IIs restriction enzymes When two or more input sequences are searched:

Show only endonucleases showing different restriction patterns for searched sequences.

Reverse Complement Gadget

	Reverse Complement - Bioinformatics Tools

Description:"Reverse Complement - Bioinformatics Tools" Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.
Author: Your Lab Data

Melting Temperature (Tm) calculator

This tool will calculate melting temperature for an oligonucleotide. Formulas for basic tm calculation are explained in the script. For Base-Stacking Tm computing, references are provided.

Microsatellite Repeats Finder

This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.

In Silico PCR Amplification

In Silico PCR Amplification

Description: Simulation of PCR amplification. Allows one mismatch between primer and template.
Author: Your Lab Data

Primer3 (Basic Edition)

Primer3 (Basic Edition)

Description:Primer3 is a widely used program for designing PCR primers (PCR = 'Polymerase Chain Reaction'). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.
Author: Your Lab Data

Els Bioquímics també la saben tocar ....

En José González és un bioquímic Suec, fill de pares argentins. És famós però per les seves cançons. Acompanyat d'una guitarra clàssica té un estil que alguns anomenen com Indie folk. Declara que el seu artista favorit és en Sílvio Rodríguez. Va publicar el seu primer disc al 2003 (que es va editar als EEUU i UK al 2005) mentre feia el doctorat en Bioquímica a la Universitat de Gothenburg. L'èxit musical però el va fer deixar els estudis de tercer cicle per dedicar-se al món de la música. El segon disc, titulat In our nature, el va presentar al Setembre del 2007. Ha declarat que algunes de les lletres d'aquest disc van ser influenciades per la lectura del llibre "El espejismo de Dios" (The God Delusion, 2006) d'en Richard Dawkins. Algunes de les seves cançons o versions han estat utilitzades en diferents episodis d'algunes de les sèries de més èxit com Bones o Brothers & Sisters i en algun anunci. La seva versió de la cançó "Massive Attack" va ser utilitzada en un episodi de la quarta temporada de la sèrie House (Massive Attack és la cançó utilitzada com a sintonia principal en aquesta sèrie).

Aquí van alguns vídeos seus:







Aquest post inaugura la secció de Bioquímics il·lustres, encara que el primer bioquímic il·lustre del que hem parlat en aquest blog ha estat en Craig Venter.